Prev. |  KEGG KO K06063 > 

RIKEN DNA Bank Human Resource - SNW1

Gene ID NCBI Gene 22938 |  KEGG hsa:22938
Gene Symbol SNW1
Protein Name SNW domain containing 1
Synonyms Bx42|FUN20|NCOA-62|PRPF45|Prp45|SKIIP|SKIP|SKIP1
Featured content Notch signaling pathway (human)
Ortholog resource in our bank

  SNW1

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX025689 IRAK064D17 pCMV-SPORT6 BC032377 NM_012245 Partial/var
HGX033778 IRAK084H10 pCMV-SPORT6 BC040112 NM_012245 Partial
HGX042858 IRAK107C10 pCMV-SPORT6 BC046105 NM_012245 Partial

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2022Apr03.csv
GNP_full_IRAL_2022Apr03.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR060834 ARe52B10 pKA1U5 NM_012245.2  
TAGCAAGCGGCAAGAATATGGCGCCTCACCAGNCTTTCCTACCNTGCACCCTACTCNGNC
HKR374923 RBd37F03 pGCAP10 NM_012245.2  
GGGTGCTGTCGCTCGCGCTGGAAGAAGCGGAAGAAGATGGCGCTCACCAGCTTTTTACCT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2022Apr03.csv
NRCDhumcloneList_RB_2022Apr03.csv


2022.09.29

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_220215.pl