Prev. |  KEGG KO K11412 > 

RIKEN DNA Bank Human Resource - SIRT2

Gene ID NCBI Gene 22933 |  KEGG hsa:22933
Gene Symbol SIRT2
Protein Name sirtuin 2
Synonyms SIR2|SIR2L|SIR2L2
Ortholog resource in our bank

  SIRT2

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY083519 IRAL008N07 pOTB7 BC003547 NM_030593 Full
HGY083723 IRAL009F03 pOTB7 BC003012 NM_030593

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE021873 W01A054L09 pENTR-TOPO flj0061g06 AK025876 NM_030593  
HGE021875 W01A054L11 pENTR-TOPO flj0061g06 AK025876 NM_030593  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR071278 ARe78D06 pKA1U5 NM_030593.1  
GGGACACAGTGGTTGGTGACGGGACAGAGCGGTCGGTGACAGCCTCAAGGGCTTCAGCAC
HKR079276 ARe98D04 pKA1U5 NM_030593.1  
GACACAGTGGTTGGTGACGGGACAGAGCGGTCGGTGACAGCCTCAAGGGCTTCAGCACCG
HKR330148 RBb25G04 pGCAP1 NM_030593.1  
GGCAGTCGGTGACGGGACACAGTGGTTGGTGACGGGACAGAGCGGTCGGTGACAGCCTCA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl