Prev. |  KEGG KO K01008 > 

RIKEN DNA Bank Human Resource - SEPHS1

Gene ID NCBI Gene 22929 |  KEGG hsa:22929
Gene Symbol SEPHS1
Protein Name selenophosphate synthetase 1
Synonyms SELD|SPS|SPS1
Ortholog resource in our bank

  SEPHS1

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX001524 IRAK003N12 pCMV-SPORT6 BC000941 NM_012247 Full
HGX056508 IRAK141E12 pCMV-SPORT6 BC063816 NM_012247 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE091619 M01C029A19 pDONR221 MGC04-A10 BC000941 ENST00000327347  
HGE091667 M01C029C19 pDONR221 MGC04-A10 BC000941 ENST00000327347  
HGE091715 M01C029E19 pDONR221 MGC04-A10 BC000941 ENST00000327347  
HGE091763 M01C029G19 pDONR221 MGC04-A10 BC000941 ENST00000327347  
HGE091811 M01C029I19 pDONR221 MGC04-A10 BC000941 ENST00000327347  
HGE091859 M01C029K19 pDONR221 MGC04-A10 BC000941 ENST00000327347  
HGE091907 M01C029M19 pDONR221 MGC04-A10 BC000941 ENST00000327347  
HGE091955 M01C029O19 pDONR221 MGC04-A10 BC000941 ENST00000327347  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR343202 RBb58A02 pGCAP1 NM_012247.3  
GGGGGAGGAGGCGGAGGGCGCAAAGCGAGCCGGTGGATCCATAAAGAACCCAGCCAACCC
HKR346882 RBb67D10 pGCAP1 NM_012247.3  
GCCCCCGCCCCCTTCCCGGGCCGCACGCCGCCACCCAGCAGCCAGGGCCGCCTCTTAAAG
HKR397654 RBd94C06 pGCAP10 NM_012247.3  
AAAAGGACCCCCGCGCGCCCAGCCGGCGGGAGCGCGGCGGCCCGGCTCCCGCAGGGCCGC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl