DNA Bank Top |  KEGG KO K25388 > 

RIKEN DNA Bank Human Resource - KIFAP3

Gene ID NCBI Gene 22920 |  KEGG hsa:22920
Gene Symbol KIFAP3
Protein Name kinesin associated protein 3
Synonyms FLA3|KAP-1|KAP-3|KAP3|SMAP|Smg-GDS|dJ190I16.1

Link

Ortholog resource in our bank

  KIFAP3

External database

human KIFAP3

Individualy Deposited Resource

Catalog number Name of Resource Description CDS comparison
Refered (NCBI mRNA) CDS status(1)
RDB20237 pCAG2-EGFP-C-KAP3 Expression vector of human KAP3, tagged with EGFP at N-terminus, CAG promoter.    

(1) CDS status was determined by comparing the plasmid sequence with NCBI RefSeq mRNA.

webcatalog20240727.tab

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY013722 IRAK034F02 pBluescriptR BC028679 NM_014970 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the plasmid sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2024May11.csv
GNP_full_IRAL_2024May11.csv

Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE042703 W01A106M15 pENTR-TOPO IRAK034F02 BC028679 NM_014970  
HGE042705 W01A106M17 pENTR-TOPO IRAK034F02 BC028679 NM_014970  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2024May11.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR420502 RBdS051E06 pGCAP10 NM_014970.2  
GAGGCCTCAGGACTGTCATCGCCTCTGGGTGTGAGGGTACTTTGGCCACCGTCCCCGGAA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2024May11.csv
NRCDhumcloneList_RB_2024May11.csv

2024.10.04

Homo_sapiens_gene_info230514.csv - RDB_hum_GIxxxxxxxxx_html_240727.pl