Prev. | Human A to Z list > N > 

RIKEN DNA Bank Human Resource - NCBP2

Gene ID (NCBI) 22916
Gene Symbol NCBP2
Protein Name nuclear cap binding protein subunit 2, 20kDa
Synonyms CBC2|CBP20|NIP1
Databases KEGG link 01 |  NCBI Gene link 01
Featured content Ortholog resources in the DNA Bank (KEGG orthology K12883)


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector(1) Sequence CDS status(3)
Submitted (DDBJ)(2) Refered (NCBI mRNA)
HGX001850 IRAK004K10 pCMV-SPORT6 BC001255 NM_007362 Full

(1) Extra 1,250 YEN (license fee) is required for Gateway® Expression Clone (pCMV SPORT6 and related vectors).
(2) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(3) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_170405.csv
GNP_full_IRAL_170405.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE004043 W01A010B19 pENTR-TOPO IRAK004K10 BC001255 NM_007362  
HGE004045 W01A010B21 pENTR-TOPO IRAK004K10 BC001255 NM_007362  

♦ W series clone contains a stop codon.

GNP_entry_W01A_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com/site/us/en/home.html


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR166075 ARi15D03 pGCAP10 NM_001042540.1  
ATTGTGGTCCGCTTCTCTGCACTATGTCGGGTGGCCTCCTGAAGGCGCTGCGCAGCGACT
HKR184427 ARi61B03 pGCAP10 NM_001042540.1  
GGCATTGTGGTCCGCTTCTCTGCACTATGTCGGGTGGCCTCCTGAAGGCGCTGCGCAGCG
HKR326826 RBb17B02 pKA1U5 NM_001042540.1  
ATCGCGGACGCAGCCTCGTGCCGGGAGTCGCCGCATTGTGGTCCGCTTCTCTGCACTATG
HKR327305 RBb18E09 pKA1U5 NM_001042540.1  
GGCGGACGCAGCCTCGTGCCGGGAGTCGCCGCATTGTGGTCCGCTTCTCTGCACTATGTC
HKR390455 RBd76C07 pGCAP10 NM_001042540.1  
GGAGGGAGGCCGGGCCGCGAGACGGGAAGGCCCTGGGCAAGAACGCTGAGAAACGGTTTG
HKR395273 RBd88D01 pGCAP10 NM_001042540.1  
GATTGTGGTCCGCTTCTCTGCACTATGTCGGGTGGCCTCCTGAAGGCGCTGCGCAGCGAC
HKR396505 RBd91E09 pGCAP10 NM_001042540.1  
GATTGTGGTCCGCTTCTCTGCACTATGTCGGGTGGCCTCCTGAAGGCGCTGCGCAGCGAC
HKR441981 RBdS104P21 pGCAP10 NM_001042540.1  
GCATCGCGGACGCAGCCTCGTGCCGGGAGTCGCCGCATTGTGGTCCGCTTCTCTGCACTA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2017.08.25

Homo_sapiens_gene_info140110 - RDB_hum_GIxxxxxxxxx_html_170416.pl