Prev. |  KEGG KO K13185 > 

RIKEN DNA Bank Human Resource - DHX30

Gene ID NCBI Gene 22907 |  KEGG hsa:22907
Gene Symbol DHX30
Protein Name DExH-box helicase 30
Synonyms DDX30|NEDMIAL|RETCOR
Ortholog resource in our bank

  DHX30

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX006171 IRAK015H03 pCMV-SPORT6 BC015029 NM_138615 Full/var
HGX010571 IRAK026H03 pCMV-SPORT6 BC020126 NM_138615
HGX020522 IRAK051F02 pCMV-SPORT6 BC038417 NM_138615 Full/var
HGX037343 IRAK093F23 pCMV-SPORT6 BC047335 NM_138615

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR264686 ARiS161L22 pGCAP10 NM_014966.2  
GAGGCCTCGGGGTCGGCGGGAGCACGATGGCGGCCGCTAGGAGACTCATGGCGCTGGCCG
HKR342123 RBb55F03 pGCAP1 NM_014966.2  
GGTAGTCCGGCCGTGGTTTGGGGGAGCCGCGGCTCATGCGCGGTGCACAGAGGCTTGTTT
HKR397260 RBd93C12 pGCAP10 NM_014966.2  
CGGCCGGCCGATGGGGGTCGGCGGGAGCACGATGGCGGCCGCTAGGAGACTCATGGCGCT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2022Apr03.csv
NRCDhumcloneList_RB_2022Apr03.csv

2023.04.25

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_220215.pl