Prev. |  KEGG KO K10488 > 

RIKEN DNA Bank Human Resource - ZBTB1

Gene ID NCBI Gene 22890 |  KEGG hsa:22890
Gene Symbol ZBTB1
Protein Name zinc finger and BTB domain containing 1
Synonyms ZNF909
Ortholog resource in our bank

  ZBTB1

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX044233 IRAK110J17 pCMV-SPORT6 BC050719 NM_014950 Partial/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE009635 W01A024B11 pENTR-TOPO IRAK110J17 BC050719 NM_014950  
HGE009637 W01A024B13 pENTR-TOPO IRAK110J17 BC050719 NM_014950  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR395207 RBd88A07 pGCAP10 NM_014950.1  
GGCCACTGCAGCTCGCGGCCCCTTCGCCTTCGCCCGCCTTTCCCGCGGCTGATTTGCCTT
HKR406093 RBdS015D21 pGCAP10 NM_014950.1  
GGTTGCAGCACAGTCCCTGGCAGAGCCAGAGCCTCTCCGCGCAGCCCAGCCCGAGCGCCG
HKR462765 RBdS156P05 pGCAP10 NM_014950.1  
TGGTAAGCGGGGCCGGCTCAGTGCGGTGCGGCAGGCGCGGCTGTGCGGCAGCGGAAGTCC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl