Prev. |  KEGG KO K09113 > 

RIKEN DNA Bank Human Resource - MLXIP

Gene ID NCBI Gene 22877 |  KEGG hsa:22877
Gene Symbol MLXIP
Protein Name MLX interacting protein
Synonyms MIR|MONDOA|bHLHe36
Ortholog resource in our bank

  MLXIP

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX001442 IRAK003K02 pCMV-SPORT6 BC028309 NM_014938 Partial/var
HGX008956 IRAK022G12 pCMV-SPORT6 BC017656 NM_014938 Partial
HGY101749 IRAL054G05 pOTB7 BC069272 NM_014938 Partial/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR050156 ARe25G12 pKA1U5 NM_014938.3  
GCCCCTCCCGCCGCGCCGCGCGCTCGCGGACAGTCGGCGCGCGGGCCGGGCCGGGCCGGC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl