Prev. | 

RIKEN DNA Bank Human Resource - INPP5F

Gene ID NCBI Gene 22876 |  KEGG hsa:22876
Gene Symbol INPP5F
Protein Name inositol polyphosphate-5-phosphatase F
Synonyms MSTP007|MSTPO47|SAC2|hSAC2
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY067555 IRAK168O19 pBluescriptR BC067820 NM_198331 Partial/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR064101 ARe60E05 pKA1U5 NM_014937.2  
GACGGCCGCCGCTGCCGCCGCCGCTGCCGGGGCGCGNTTCTCCTCCTACCGGTCGGGTGC
HKR208019 ARiS020A19 pGCAP10 NM_014937.2  
GCTCTACGGCCGCCGCTGCCGCCGCCGCTGCCGGGGCGCGTTCTCCTCCTACCGGTCGGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl