Prev. |  KEGG KO K14005 > 

RIKEN DNA Bank Human Resource - SEC31A

Gene ID NCBI Gene 22872 |  KEGG hsa:22872
Gene Symbol SEC31A
Protein Name SEC31 homolog A, COPII coat complex component
Synonyms ABP125|ABP130|HSPC275|HSPC334|NEDSOSB|SEC31L1
Ortholog resource in our bank

  SEC31A

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX069918 IRAK174N06 pCMV-SPORT6 BC084583 NM_016211 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR041729 ARe04F09 pKA1U5 NM_014933.2  
AGCTTTGAGGTAGAGCCCAGGCCAAAACTGGGACCGCAGCCTGGGTCTCCGCTGCCCCGC
HKR044125 ARe10F05 pKA1U5 NM_014933.2  
GCCTTCTGTTTTCACCCATTCTGGCACAATCTGGCGCCATCGTCCTTCTTGTGAGGCCAA
HKR205201 ARiS013A01 pGCAP10 NM_014933.2  
GAGTCCGACGAGCGCNNCACTAACGCAGGATCCGGCTGCCGAAGGTCCTCGCCAGCAGGA
HKR205205 ARiS013A05 pGCAP10 NM_014933.2  
GAGTCCNANNAGCNNNGCNCTAACGCAGGATCCGGCTGCCGAAGGTCCTCGCCAGCAGGA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl