Prev. |  KEGG KO K18190 > 

RIKEN DNA Bank Human Resource - FASTKD2

Gene ID NCBI Gene 22868 |  KEGG hsa:22868
Gene Symbol FASTKD2
Protein Name FAST kinase domains 2
Synonyms KIAA0971
Ortholog resources KEGG ortholog (KEGG orthology K18190) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX001679 IRAK004D07 pCMV-SPORT6 BC001544 NM_014929

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR062082 ARe55D10 pKA1U5 NM_014929.3  
GTCATGGCTGCTCCTGTACGTAGGTCACGGTCTNNCTGCTCTNAGGAAAACGACAGCACG
HKR364552 RBd11G08 pGCAP10 NM_014929.3  
AACAAAGGGCATAAGCACTCTAACAGCCCTTAGAATTGAAAGACTACTTTATGCTAAAAG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.20

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl