Prev. |  KEGG KO K13499 > 

RIKEN DNA Bank Human Resource - CHSY1

Gene ID NCBI Gene 22856 |  KEGG hsa:22856
Gene Symbol CHSY1
Protein Name chondroitin sulfate synthase 1
Synonyms CHSY|CSS1|ChSy-1|TPBS
Ortholog resource in our bank

  CHSY1

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX033022 IRAK082J06 pCMV-SPORT6 BC046247 NM_014918 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE080833 M01C002B09 pDONR221 04-134-2_1-G05 BC046247 ENST00000254190  
HGE080881 M01C002D09 pDONR221 04-134-2_1-G05 BC046247 ENST00000254190  
HGE080929 M01C002F09 pDONR221 04-134-2_1-G05 BC046247 ENST00000254190  
HGE080977 M01C002H09 pDONR221 04-134-2_1-G05 BC046247 ENST00000254190  
HGE081025 M01C002J09 pDONR221 04-134-2_1-G05 BC046247 ENST00000254190  
HGE081073 M01C002L09 pDONR221 04-134-2_1-G05 BC046247 ENST00000254190  
HGE081121 M01C002N09 pDONR221 04-134-2_1-G05 BC046247 ENST00000254190  
HGE081169 M01C002P09 pDONR221 04-134-2_1-G05 BC046247 ENST00000254190  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR048905 ARe22E09 pKA1U5 NM_014918.3  
GAGGGGCTCCTGNTTGCAATGGCGAGCTAAGCCGCGATGATGTGCAGCCTGCGGCGGCGG
HKR164409 ARi11A09 pGCAP10 NM_014918.3  
GGGCTCCTGTTGCAATGGCGAGCTAAGCCGGAGGATGTGCAGCTGCGGCGGCGGCGCCGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl