Prev. | 

RIKEN DNA Bank Human Resource - ANKRD26

Gene ID NCBI Gene 22852 |  KEGG hsa:22852
Gene Symbol ANKRD26
Protein Name ankyrin repeat domain 26
Synonyms THC2|bA145E8.1
Links

  KEGG gene

  NCBI Gene


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR398459 RBd96C11 pGCAP10 NM_014915.2  
GGGAGTTTCCTTTGGGAGGCTGCGGCCAGCCGGGGCTGACTTGTTATGTTGGGCTCCGGA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2021.03.25

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl