Prev. |  KEGG KO K12838 > 

RIKEN DNA Bank Human Resource - PUF60

Gene ID NCBI Gene 22827 |  KEGG hsa:22827
Gene Symbol PUF60
Protein Name poly(U) binding splicing factor 60
Synonyms FIR|RoBPI|SIAHBP1|VRJS
Ortholog resources KEGG ortholog (KEGG orthology K12838) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX004857 IRAK012C09 pCMV-SPORT6 BC011265 NM_078480 Partial/var
HGX005638 IRAK014B14 pCMV-SPORT6 BC009734 NM_014281 Partial/var
HGX008603 IRAK021I11 pCMV-SPORT6 BC011979 NM_078480 Partial
HGY090701 IRAL026M13 pOTB7 BC008875 NM_014281 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE025274 W01A063D02 pENTR-TOPO IRAL026M13 BC008875 NM_014281  
HGE025276 W01A063D04 pENTR-TOPO IRAL026M13 BC008875 NM_014281  

♦ W series clone contains a stop codon.

GNP_entry_W01A_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR081283 ARf03D11 pKA1U5 NM_014281.3  
GGACGGACGCAAGATGGCGACGGCGACCATAGCTCTCCAGGTCAATGGCCAGCAAGGAGG
HKR160473 ARi01D01 pGCAP10 NM_014281.3  
GGGGAGGCGCGCGCGGAGGCCGCGACGGACGCAAGATGGCGACGGCGACCATAGCTCTCC
HKR322951 RBb07G07 pKA1U5 NM_014281.3  
GACGGACGCAAGATGGCGACGGCGACCATAGCTCTCCAGGTCAATGGCCAGCAAGGAGGG
HKR361626 RBd04B02 pGCAP10 NM_014281.3  
HKR370507 RBd26E11 pGCAP10 NM_014281.3  
GGACGGACGCAAGATGGCGACGGCGACCATAGCTCTCCAGGTCAATGGCCAGCAAGGAGG
HKR393674 RBd84D02 pGCAP10 NM_014281.3  
GAGTAGGAGAGACTGGTGCTTGCCCCGCCCGGTGGACTAACTCGCTTAATTTTAAATAAA
HKR393675 RBd84D03 pGCAP10 NM_014281.3  
GGGACGCAAGATGGCGACGGCGACCATAGCTCTCCAGGTCAATGGCCAGCAAGGAGGGGG
HKR396573 RBd91H05 pGCAP10 NM_014281.3  
GGACGGACGCAAGATGGCGACGGCGACCATAGCTCTCCAGGTCAATGGCCAGCAAGGAGG
HKR442227 RBdS105J11 pGCAP10 NM_014281.3  
GGCGCGCGCGGAGGCCGCGACGGACGCAAGATGGCGACGGCGACCATAGCTCTCGTCAAT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.20

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl