Prev. |  KEGG KO K09528 > 

RIKEN DNA Bank Human Resource - DNAJC8

Gene ID NCBI Gene 22826 |  KEGG hsa:22826
Gene Symbol DNAJC8
Protein Name DnaJ heat shock protein family (Hsp40) member C8
Synonyms HSPC331|SPF31
Ortholog resource in our bank

  DNAJC8

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY097277 IRAL043D05 pOTB7 BC033159 NM_014280 Partial

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR064811 ARe62A11 pKA1U5 NM_014280.2  
GGGGGAAATGGCGGCTTCAGGAGAGAGCGGGACTTCAGGCGGCGGAGGCAGCACCGAGGA
HKR070974 ARe77H06 pKA1U5 NM_014280.2  
GAGGGTCACGTGGTGGCTGGGCCGGGGAAATGCCNTTTTTCAGGAGAGAGCGGGACTTCA
HKR074834 ARe87B10 pKA1U5 NM_014280.2  
GGGGGAAATGGCGGCTTCAGGAGAGAGCGGGACTTCAGGCGGCGGAGGCAGCACCGAGGA
HKR075659 ARe89C11 pKA1U5 NM_014280.2  
GGGTGGCTGGGCCGGGGAAATGGCGGCTTCAGGAGAGAGCGGGACTTCAGGCGGCGGAGG
HKR163776 ARi09H08 pGCAP10 NM_014280.2  
GGCTGGGCCGGGGAAATGGCGGCTTCAGGAGAGAGCGGGACTTCAGGCGGCGGAGGCAGC
HKR203212 ARiS008A12 pGCAP10 NM_014280.2  
TGGCCTGCGCAGAAGGGTCACGTGGTGGCTGGGCCGGGGAAATGGCGGCTTCAGGAGAGA
HKR209487 ARiS023L23 pGCAP10 NM_014280.2  
GGGGGAAATGGCGGCTTCNGGANAGAGCGGGACTTCAGGCGGCGGANGCNGCACCGAGGA
HKR376832 RBd42B08 pGCAP10 NM_014280.2  
GGCCTGCGCAGAAGGGTCACGTGGTGGCTGGGCCGGGGAAATGGCGGCTTCAGGAGAGAG
HKR405475 RBdS013L11 pGCAP10 NM_014280.2  
GAGAANGGTCACGTGGTGGCTGGGCCGGGGAAATGGCGGCTTCAGGAGAGAGCGGGACTT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl