Prev. |  KEGG KO K17267 > 

RIKEN DNA Bank Human Resource - COPG1

Gene ID NCBI Gene 22820 |  KEGG hsa:22820
Gene Symbol COPG1
Protein Name COPI coat complex subunit gamma 1
Synonyms COPG
Ortholog resource in our bank

  COPG1

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX008991 IRAK022H23 pCMV-SPORT6 BC020498 NM_016128 Partial
HGX056075 IRAK140D03 pCMV-SPORT6 BC066650 NM_016128 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR222228 ARiS055J12 pGCAP10 NM_016128.3  
TGGTCCCTGTAGAACCACTGTGGCACCGCTACTCCGTGCCGCGCCCGTCGAGCATTGCGT
HKR335332 RBb38F12 pGCAP1 NM_016128.3  
TGAGTCGGGGCCCGGAAGTGGTCCCTGTAGAACCACTGTGGCACCGCTACTCCGTGCCGC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl