Prev. |  KEGG KO K20472 > 

RIKEN DNA Bank Human Resource - COPZ1

Gene ID NCBI Gene 22818 |  KEGG hsa:22818
Gene Symbol COPZ1
Protein Name coatomer protein complex subunit zeta 1
Synonyms CGI-120|COPZ|HSPC181|zeta-COP|zeta1-COP
Ortholog resources KEGG ortholog (KEGG orthology K20472) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY085130 IRAL012N18 pOTB7 BC002849 NM_016057 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR162080 ARi05D08 pGCAP10 NM_016057.1  
GGGCACCAGCTGCGGGGCAAGATGGAGGCGCTGATTTTGGAACCTTCCCTGTATACTGTC
HKR218230 ARiS045J14 pGCAP10 NM_016057.1  
GGCGGCTCCACGTCGGCACCAGCTGCGGGGCAAGATGGAGGCGCTGATTTTGGAACCTTC
HKR235079 ARiS087L15 pGCAP10 NM_016057.1  
HKR372079 RBd30D07 pGCAP10 NM_016057.1  
GGGCGTTTCTTTTGCGGCTCCACGTCGGCACCAGCTGCGGGGCAAGATGGAGGCGCTGAT
HKR378855 RBd47C07 pGCAP10 NM_016057.1  
GGCGGCTCCACGTCGGCACCAGCTGCGGGGCAAGATGGAGGCGCTGATTTTGGAACCTTC
HKR387205 RBd68A05 pGCAP10 NM_016057.1  
GGCGGCTCCACGTCGGCACCAGCTGCGGGGCAAGATGGAGGCGCTGATTTTGGAACCTTC
HKR428162 RBdS070G18 pGCAP10 NM_016057.1  
GGGCACCAGCTGCGGGGCAAGATGGAGGCGCTGATTTTGGAACCTTCCCTGTATACTGTC
HKR444369 RBdS110P09 pGCAP10 NM_016057.1  
ACGTCGGCACCAGCTGCGGGGCAAGATGGAGGCGCTGATTTTGGAACCTTCCCTGTATAC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.20

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl