Prev. |  KEGG KO K09044 > 

RIKEN DNA Bank Human Resource - ATF5

Gene ID NCBI Gene 22809 |  KEGG hsa:22809
Gene Symbol ATF5
Protein Name activating transcription factor 5
Synonyms ATFX|HMFN0395
Ortholog resource in our bank

  ATF5

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY083061 IRAL007K21 pOTB7 BC005174 NM_012068 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE001127 W01A002N15 pENTR-TOPO IRAL007K21 BC005174 NM_012068  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR362454 RBd06C06 pGCAP10 NM_012068.4  
GATTCCCTGTCCTCGGATCACAGTCTCTTCTCACTACAGTGTCGCCGCCTCTGCCTGCGT
HKR375354 RBd38G10 pGCAP10 NM_012068.4  
GTCTCATTCCCTGTCCTCGGATCACAGTCTCTTCTCACTACAGTGTCGCCGCCTCTGCCT
HKR380576 RBd51H08 pGCAP10 NM_012068.4  
GATTCCCTGTCCTCGGATCACAGTCTCTTCTCACTACAGTGTCGCCGCCTCTGCCTGCGT
HKR405962 RBdS014P02 pGCAP10 NM_012068.4  
GATTCCCTGTCCTCGGATCACAGTCTCTTCTCACTACAGTGTCGCCGCCTCTGCCTGCGT
HKR444324 RBdS110N12 pGCAP10 NM_012068.4  
GATTCCCTGTCCTCGGATCACAGTCTCTTCTCACTACAGTGTCGCCGCCTCTGCCTGCGT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl