Prev. | Human A to Z list > A > 

RIKEN DNA Bank Human Resource - ATF5

Gene ID (NCBI) 22809
Gene Symbol ATF5
Protein Name activating transcription factor 5
Synonyms ATFX|HMFN0395
Databases KEGG link 01 |  NCBI Gene link 01
Featured content Ortholog resources in the DNA Bank (KEGG orthology K09044)


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector(1) Sequence CDS status(3)
Submitted (DDBJ)(2) Refered (NCBI mRNA)
HGY083061 IRAL007K21 pOTB7 BC005174 NM_012068 Full/var

(1) Extra 1,250 YEN (license fee) is required for Gateway® Expression Clone (pCMV SPORT6 and related vectors).
(2) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(3) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_170405.csv
GNP_full_IRAL_170405.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE001127 W01A002N15 pENTR-TOPO IRAL007K21 BC005174 NM_012068  

♦ W series clone contains a stop codon.

GNP_entry_W01A_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com/site/us/en/home.html


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR362454 RBd06C06 pGCAP10 NM_012068.4  
GATTCCCTGTCCTCGGATCACAGTCTCTTCTCACTACAGTGTCGCCGCCTCTGCCTGCGT
HKR375354 RBd38G10 pGCAP10 NM_012068.4  
GTCTCATTCCCTGTCCTCGGATCACAGTCTCTTCTCACTACAGTGTCGCCGCCTCTGCCT
HKR380576 RBd51H08 pGCAP10 NM_012068.4  
GATTCCCTGTCCTCGGATCACAGTCTCTTCTCACTACAGTGTCGCCGCCTCTGCCTGCGT
HKR405962 RBdS014P02 pGCAP10 NM_012068.4  
GATTCCCTGTCCTCGGATCACAGTCTCTTCTCACTACAGTGTCGCCGCCTCTGCCTGCGT
HKR444324 RBdS110N12 pGCAP10 NM_012068.4  
GATTCCCTGTCCTCGGATCACAGTCTCTTCTCACTACAGTGTCGCCGCCTCTGCCTGCGT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2017.08.25

Homo_sapiens_gene_info140110 - RDB_hum_GIxxxxxxxxx_html_170416.pl