Prev. |  KEGG KO K07831 > 

RIKEN DNA Bank Human Resource - MRAS

Gene ID NCBI Gene 22808 |  KEGG hsa:22808
Gene Symbol MRAS
Protein Name muscle RAS oncogene homolog
Synonyms M-RAs|NS11|R-RAS3|RRAS3
Featured content Mitophagy - human
Ortholog resource in our bank

  MRAS

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX008032 IRAK020B08 pCMV-SPORT6 BC017733 NM_012219 Partial/var
HGY013062 IRAK032K22 pBluescriptR BC035939 NM_012219 Full
HGY036693 IRAK091M05 pBluescript BC047101 NM_012219 Partial/var
HGX039276 IRAK098D04 pCMV-SPORT6 BC047690 NM_012219 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE126003 M01C115A03 pDONR221 1_5-A02 BC047690 ENST00000289104  
HGE095203 M01C038A03 pDONR221 MGC08-E02 BC047690 ENST00000289104  
HGE095251 M01C038C03 pDONR221 MGC08-E02 BC047690 ENST00000289104  
HGE095299 M01C038E03 pDONR221 MGC08-E02 BC047690 ENST00000289104  
HGE095347 M01C038G03 pDONR221 MGC08-E02 BC047690 ENST00000289104  
HGE095395 M01C038I03 pDONR221 MGC08-E02 BC047690 ENST00000289104  
HGE095443 M01C038K03 pDONR221 MGC08-E02 BC047690 ENST00000289104  
HGE095491 M01C038M03 pDONR221 MGC08-E02 BC047690 ENST00000289104  
HGE095539 M01C038O03 pDONR221 MGC08-E02 BC047690 ENST00000289104  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR166007 ARi15A07 pGCAP10 NM_012219.3  
GGCTCGGCCGCGCTCTCCGCTTGCGGGGTGCGCCCTGGGACCGGCTGTGCGTGGCGTTTT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl