Prev. |  KEGG KO K12619 > 

RIKEN DNA Bank Human Resource - XRN2

Gene ID NCBI Gene 22803 |  KEGG hsa:22803
Gene Symbol XRN2
Protein Name 5'-3' exoribonuclease 2
Synonyms -
Ortholog resource in our bank

  XRN2

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY080517 IRAL001E21 pOTB7 BC000315 NM_012255 Partial/var
HGY087334 IRAL018F14 pOTB7 BC006417 NM_012255 Partial

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE024146 W01A060G02 pENTR-TOPO flj0034f12 AK001573 NM_012255  
HGE033070 W01A082L06 pENTR-TOPO flj0034f12 AK001573 NM_012255  
HGE033072 W01A082L08 pENTR-TOPO flj0034f12 AK001573 NM_012255 done
HGE033076 W01A082L12 pENTR-TOPO flj0034f12 AK001573 NM_012255  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR182076 ARi55D04 pGCAP10 NM_012255.3  
GANGCTCTTCAGCCGGTCGGCCGCCGCCTCCACCCGTGTGCCGCTATGGGAGTCCCGGCG
HKR182121 ARi55F01 pGCAP10 NM_012255.3  
GACGCTCGTCAGCCGGTCGGCCGCCGCCTCCAGCCGTGTGCCGCTATGGGAGTCCCGGCG
HKR182149 ARi55G05 pGCAP10 NM_012255.3  
GACGCTCGTCAGCCGGTCGGCCGCCGCCTCCAGCCGTGTGCCGCTATGGGAGTCCCGGCG
HKR394946 RBd87G02 pGCAP10 NM_012255.3  
GGCACGTGGGAGGAAGTGCTGGTGCCCTCTGCCGCTGCTCCCGTCTCTTTGGTTACGCTC
HKR453077 RBdS132L13 pGCAP10 NM_012255.3  
GAGGAAGTGCTGGTGCCCTCTGCCGCTGCTCCCGTCTCTTTGGTTACGCTCGTCAGCCGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl