Prev. |  KEGG KO K20289 > 

RIKEN DNA Bank Human Resource - COG2

Gene ID NCBI Gene 22796 |  KEGG hsa:22796
Gene Symbol COG2
Protein Name component of oligomeric golgi complex 2
Synonyms CDG2Q|LDLC
Ortholog resources KEGG ortholog (KEGG orthology K20289) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX044044 IRAK110B20 pCMV-SPORT6 BC051906 NM_007357 Full/var
HGY093906 IRAL034M18 pOTB7 BC014960 NM_007357 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR203386 ARiS008H18 pGCAP10 NM_007357.2  
GGTGGAAACTGGCGGTGGCCGCGGCCGCCGAGTCGGTCTGCGCAGCCTCCTGCGTTTTCT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.20

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl