DNA Bank Top |  KEGG KO K08341 > 

RIKEN DNA Bank Human Resource - GABARAPL2

Gene ID NCBI Gene 11345 |  KEGG hsa:11345
Gene Symbol GABARAPL2
Protein Name GABA type A receptor associated protein like 2
Synonyms ATG8|ATG8C|GATE-16|GATE16|GEF-2|GEF2
Featured content Autophagy (human)
Featured content Mitophagy - human

Link

Ortholog resource in our bank

  GABARAPL2


External database

human GABARAPL2

Individualy Deposited Resource

Catalog number Name of Resource Description CDS comparison
Refered (NCBI mRNA) CDS status(1)
RDB19201 pcDNA3.1 3xFLAG::GABARAPL2 Expression vectors of human ATG8 homolog GABARAPL2 tagged with 3xFLAG at N-terminus.    

(1) CDS status was determined by comparing the plasmid sequence with NCBI RefSeq mRNA.

webcatalog20240727.tab


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY013237 IRAK033B13 pBluescriptR BC014594 NM_007285 Full
HGY025502 IRAK063M14 pBluescriptR BC029601 NM_007285 Full
HGY029054 IRAK072K14 pBluescriptR BC040312 NM_007285 Partial
HGY088524 IRAL021F04 pDNR-LIB BC005985 NM_007285 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the plasmid sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2024May11.csv
GNP_full_IRAL_2024May11.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR052055 ARe30C07 pKA1U5 NM_007285.6  
GGTCGCTGCCGCTGCCGCTGCCGCCGTCGTTGTTGTTGTGCTCGGTGCGCTGAGCTCCGC
HKR058927 ARe47F07 pKA1U5 NM_007285.6  
GAGTCGCCGCCGNTCGCTGCCGCTGCCGCTGCCGCCGTTCGTTGTTGTTGTGCTCGGTGC
HKR072951 ARe82G07 pKA1U5 NM_007285.6  
GGTAGTCGCCGCCGNTCGCTGCCGCTGCCGCTGCCGCCGNTCGNTTGTTGTTGTGCTCGG
HKR222158 ARiS055G14 pGCAP10 NM_007285.6  
GGCTGCCGCCGTCGTTGTTGTTGTGCTCGGTGCGCTGAGCTCCGCGGCTCCGCGAGCCGG
HKR222233 ARiS055J17 pGCAP10 NM_007285.6  
GTGTAGTCGCCGCCGTCGCTGCCGCTGCCGCTGCCGCCGTCGTTGTTGTTGTGCTCGGTG
HKR248912 ARiS122E16 pGCAP10 NM_007285.6  
TTCAGTCGCCGCCGTCGCTGCCGCTGCCGCTGCCGCCGTCGTTGTTGTTGTGCTCGGTGC
HKR364504 RBd11E08 pGCAP10 NM_007285.6  
GCTGCCGTGTAGTCGCCGCCGTCGCTGCCGCTGCCGCTGCCGCCGTCGTTGTTGTTGTGC
HKR396853 RBd92C05 pGCAP10 NM_007285.6  
GAGTCGCCGCCGTCGCTGCCGCTGCCGCTGCCGCCGTCGTTGTTGTTGTGCTCGGTGCGC
HKR403127 RBdS007N15 pGCAP10 NM_007285.6  
GAGTCGCCGCCGTCGCTGCCGCTGCCGCTGCCGCCGTCGTTGTTGTTGTGCTCGGTGCGC
HKR470978 RBdS177H10 pGCAP10 NM_007285.6  
GCTGCCGTGTAGTCGCCGCCGTCGCTGCCGCTGCCGCTGCCGCCGTCGTTGTTGTTGTGC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2024May11.csv
NRCDhumcloneList_RB_2024May11.csv


No Approval Forms Required for Fluorescent Protein Genes Developed by Dr. Atsushi Miyawaki
♦ RIKEN BRC will be closed from December 28, 2024 through January 5, 2025 due to New Year's holidays.
A bicistronic cell cycle reporter, Fucci2a (Sep 17, 2024)
Monomeric Fluorescent Protein Resource, mStayGold (Dec 18, 2023)
Visualization of Organelles update (Dec 18, 2023)
Development of two mouse strains conditionally expressing bright luciferases (Sep 08, 2023)
Autophagy and Mitophagy Updates (Aug 16, 2023)
High intensity forms of luciferase and luminescent proteins from various organisms (BRC RESOURCE NEWS) (Apr 28, 2023)
Plasmid of Cas9 expression/mRNA production, evaluation of the genome edit efficiency, and Knock-in donors and tags
Fucci cell cycle indicator, Calcium sensor and Fluorescent and Luminescent protein resources
Revision of Distribution Fees for Bioresources in RIKEN BRC
- - - - - - - - - - - - - - - - - - - -
Mail News sign-up. Receive information of the forcusd resources, new available resources and more.
♦ Please visit "Terms of Use", "Quality control" and "Ordering instruction"
Dnaconda's recommendation BRC Resource News RIKEN BRC 20th RIKEN BRC News sign-up

2024.10.03

Homo_sapiens_gene_info230514.csv - RDB_hum_GIxxxxxxxxx_html_240727.pl