Prev. |  KEGG KO K08341 > 

RIKEN DNA Bank Human Resource - GABARAPL2

Gene ID NCBI Gene 11345 |  KEGG hsa:11345
Gene Symbol GABARAPL2
Protein Name GABA type A receptor associated protein like 2
Synonyms ATG8|ATG8C|GATE-16|GATE16|GEF-2|GEF2
Ortholog resources KEGG ortholog (KEGG orthology K08341) in the DNA Bank
Featured content Autophagy (human)
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY013237 IRAK033B13 pBluescriptR BC014594 NM_007285 Full
HGY025502 IRAK063M14 pBluescriptR BC029601 NM_007285 Full
HGY029054 IRAK072K14 pBluescriptR BC040312 NM_007285 Partial
HGY088524 IRAL021F04 pDNR-LIB BC005985 NM_007285 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR052055 ARe30C07 pKA1U5 NM_007285.6  
GGTCGCTGCCGCTGCCGCTGCCGCCGTCGTTGTTGTTGTGCTCGGTGCGCTGAGCTCCGC
HKR058927 ARe47F07 pKA1U5 NM_007285.6  
GAGTCGCCGCCGNTCGCTGCCGCTGCCGCTGCCGCCGTTCGTTGTTGTTGTGCTCGGTGC
HKR072951 ARe82G07 pKA1U5 NM_007285.6  
GGTAGTCGCCGCCGNTCGCTGCCGCTGCCGCTGCCGCCGNTCGNTTGTTGTTGTGCTCGG
HKR222158 ARiS055G14 pGCAP10 NM_007285.6  
GGCTGCCGCCGTCGTTGTTGTTGTGCTCGGTGCGCTGAGCTCCGCGGCTCCGCGAGCCGG
HKR222233 ARiS055J17 pGCAP10 NM_007285.6  
GTGTAGTCGCCGCCGTCGCTGCCGCTGCCGCTGCCGCCGTCGTTGTTGTTGTGCTCGGTG
HKR248912 ARiS122E16 pGCAP10 NM_007285.6  
TTCAGTCGCCGCCGTCGCTGCCGCTGCCGCTGCCGCCGTCGTTGTTGTTGTGCTCGGTGC
HKR364504 RBd11E08 pGCAP10 NM_007285.6  
GCTGCCGTGTAGTCGCCGCCGTCGCTGCCGCTGCCGCTGCCGCCGTCGTTGTTGTTGTGC
HKR396853 RBd92C05 pGCAP10 NM_007285.6  
GAGTCGCCGCCGTCGCTGCCGCTGCCGCTGCCGCCGTCGTTGTTGTTGTGCTCGGTGCGC
HKR403127 RBdS007N15 pGCAP10 NM_007285.6  
GAGTCGCCGCCGTCGCTGCCGCTGCCGCTGCCGCCGTCGTTGTTGTTGTGCTCGGTGCGC
HKR470978 RBdS177H10 pGCAP10 NM_007285.6  
GCTGCCGTGTAGTCGCCGCCGTCGCTGCCGCTGCCGCTGCCGCCGTCGTTGTTGTTGTGC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.20

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl