Prev. | Human A to Z list > T > 

RIKEN DNA Bank Human Resource - TWF2

Gene ID (NCBI) 11344
Gene Symbol TWF2
Protein Name twinfilin actin-binding protein 2
Synonyms A6RP|A6r|PTK9L
Databases KEGG link 01 |  NCBI Gene link 01
Featured content Kinases Included in Myristoylated Kinase Library (human) in Boehm JS Cell 129 (6):1065-1079 (2007). PMID: 17574021.


Genome Network Project (GNP) Human Full-Length cDNA Clone link 01

Catalog number Clone name Vector(1) Sequence CDS status(3)
Submitted (DDBJ)(2) Refered (NCBI mRNA)
HGX007811 IRAK019I19 pCMV-SPORT6 BC016452 NM_007284 Full
HGY080567 IRAL001G23 pOTB7 BC000327 NM_007284 Full
HGY083686 IRAL009D14 pOTB7 BC003161 NM_007284 Full

(1) Extra 1,250 YEN (license fee) is required for Gateway® Expression Clone (pCMV SPORT6 and related vectors).
(2) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(3) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_160505.csv
GNP_full_IRAL_160505.csv


NRCD Human Full-Legth cDNA Clone link 01

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR162178 ARi05H10 pGCAP10 NM_007284.3  
GACCGCCCGGGAAGCTGCGCGAGGGTCGACAGCCTCCGCCACATCCTCCACCTCTCTTGG
HKR169228 ARi23B04 pGCAP10 NM_007284.3  
GCTCCGCCACATCCTCCACCTCTCTTGGTCCAGCGAGCGTTGCCGGGCCAGGGTCAAGCG
HKR170080 ARi25D08 pGCAP10 NM_007284.3  
GCTGCGGCACCGCCCGGGAAGCTGCGCGAGGGTCGACAGCCTCCGCCACATCCTCCACCT
HKR238566 ARiS096G22 pGCAP10 NM_007284.3  
GACATCCTCCACCTCTCTTGGTCCAGCGAGCGTTGCCGGGCCAGGGTCAAGCGGAGGGCT
HKR339748 RBb49G04 pGCAP1 NM_007284.3  
GGGTCCTGCGGCACCGCCCGGGAAGCTGCGCGAGGGTCGACAGNCTCCGCCACATCCTCC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2016.12.28

Homo_sapiens_gene_info140110 - RDB_hum_GIxxxxxxxxx_html_161013.pl