Prev. |  KEGG KO K12837 > 

RIKEN DNA Bank Human Resource - U2AF2

Gene ID NCBI Gene 11338 |  KEGG hsa:11338
Gene Symbol U2AF2
Protein Name U2 small nuclear RNA auxiliary factor 2
Synonyms U2AF65
Ortholog resource in our bank

  U2AF2

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY082012 IRAL005A12 pOTB7 BC008740 NM_007279 Full/var
HGY089904 IRAL024M16 pOTB7 BC030574 NM_007279 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE025266 W01A063C18 pENTR-TOPO IRAL024M16 BC030574 NM_007279  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR325726 RBb14F06 pKA1U5 NM_007279.2  
HKR367280 RBd18D08 pGCAP10 NM_007279.2  
GGGAGCGGGCGGCAAGGCGAGGCGAAAGCTGCACAGGGCCCTACGCGGCCGCCTCAGCAT
HKR379678 RBd49D06 pGCAP10 NM_007279.2  
GATTAGGTAGGAGGTGGCGAAGCGCCGGCGGCGGCCGGAAGTAGCCGAAGCCAGCGGCGG
HKR379683 RBd49D11 pGCAP10 NM_007279.2  
GGAAGCCAGCGGCGGAAGTAGCCGAAGCGGCTGGAGCGGGCGGCAAGGCGAGGCGAAAGC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl