Prev. | Human A to Z list > G > 

RIKEN DNA Bank Human Resource - GABARAP

Gene ID (NCBI) 11337
Gene Symbol GABARAP
Protein Name GABA type A receptor-associated protein
Synonyms ATG8A|GABARAP-a|MM46
Databases KEGG hsa:11337 |  NCBI Gene 11337
Featured content Autophagy (human)
Featured content Ortholog resources in the DNA Bank (KEGG orthology K08341)


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR042106 ARe05E10 pKA1U5 NM_007278.1  
GGCCGTCGTCGCCGCCCCCCGNTCCCGGCCCCCCTGGGTTCCCTCAGCCCAGCCCTGTCC
HKR046951 ARe17G07 pKA1U5 NM_007278.1  
GGTCCCGGCCCCCCTGGGTTCCCTCAGCCCAGCCCTGTTCCAGCCCGGTTCCCGGGAGGA
HKR047210 ARe18A10 pKA1U5 NM_007278.1  
GGCTGAATCCGCCCGCGCGTCGCCGCCGNTCGTCGCCGCCCCCCGNTCCCGGCCCCCCTG
HKR047610 ARe19A10 pKA1U5 NM_007278.1  
GCCCCCGNTCCCGGCCCCCCTGGGTTCCCTCAGCCCAGCCCTGNTCCAGCCCGGTTCCCG
HKR052899 ARe32E03 pKA1U5 NM_007278.1  
GGTTCCCTCAGCCCAGCCCTGTCCAGCCCGGTTCCCGGGAGGATGAAGTTCGTGTACAAA
HKR058835 ARe47B11 pKA1U5 NM_007278.1  
GCCCGGCCCCCCTGGGTTCCCTCAGCCCAGCCCTGTCCAGCCCGGTTCCCGGGAGGATGA
HKR070479 ARe76D07 pKA1U5 NM_007278.1  
GGCAAATTCGTGGATCGCTCCGCTGAATCCGCCCGTTTNNATCGCCGCCGTCGTCGCCGC
HKR079681 ARe99D09 pKA1U5 NM_007278.1  
TGCTGTCCAGCCCGGTTCCCGGGAGGATGAAGTTCGTGTACAAAGAAGAGCATCCGTTCG
HKR081729 ARf04F09 pKA1U5 NM_007278.1  
GGCGCAAATTCGTGGATCGCTCCGCTGAATCCGCCCGCGCGTCGCCGCCGTCGTCGCCGC
HKR082130 ARf05F10 pKA1U5 NM_007278.1  
TGAGCCCTGTCCAGCCCGGTTCCCGGGAGGATGAAGTTCGTGTACAAAGAAGAGCATCCG
HKR082546 ARf06G02 pKA1U5 NM_007278.1  
GCCCGTCCCGGCCCCCCTGGGTTCCCTCAGCCCAGCCCTGNTCCAGCCCGGTTCCCGGGA
HKR082949 ARf07G05 pKA1U5 NM_007278.1  
GGCCGTCGTCGCCGCCCCCCGNTCCCGGCCCCCCTGGNTTTCCCTCAGCCCAGCCCTGTC
HKR176531 ARi41F11 pGCAP10 NM_007278.1  
GGCAAATTCGTGGATCGCTCCGCTGAATCCGCCCGCGCGTCGCCGCCGTCGTCGCCGCCC
HKR247359 ARiS118G15 pGCAP10 NM_007278.1  
GAGCCCTGTCCAGCCCGGTTCCCGGGAGGATGAAGTTCGTGTACAAAGAAGAGCATCCGT
HKR321322 RBb03F02 pKA1U5 NM_007278.1  
GGCTGCACCGCGNTGTACAAAGACAAAGAGATGAATCTGGGGTAGATTTAGGTGCTAGGA
HKR327721 RBb19F01 pKA1U5 NM_007278.1  
HKR328451 RBb21C03 pKA1U5 NM_007278.1  
GCCCGTCCCGGCCCCCCTGGGTTCCCTCAGCCCAGCCCTGNTCCAGCCCGGTTCCCGGGA
HKR333636 RBb34B12 pGCAP1 NM_007278.1  
TATGGCTGCACCGCGTGTACAAAGACAAAGAGATGAATCTGGGGTAGATTTAGGTGCTAG
HKR334879 RBb37D07 pGCAP1 NM_007278.1  
GCCCAGCCCTGNTCCAGCCCGGTTCCCGGGAGGATGAAGTTTCGTGTACAAAGAAGAGCA
HKR335778 RBb39H10 pGCAP1 NM_007278.1  
TGCCAGCCCTGTCCAGCCCGGTTCCCGGGAGGATGAAGTTCGTGTACAAAGAAGAGCATC
HKR348007 RBb70A07 pGCAP1 NM_007278.1  
GCCCCGTCCCGGCCCCCCTGGGTTCCCTCAGCCCAGCCCTGTCCAGCCCGGTTCCCGGGA
HKR371673 RBd29D01 pGCAP10 NM_007278.1  
GCCCGGCCCCCCTGGGTTCCCTCAGCCCAGCCCTGTCCAGCCCGGTTCCCGGGAGGATGA
HKR373277 RBd33D05 pGCAP10 NM_007278.1  
GCCCCCCGTCCCGGCCCCCCTGGGTTCCCTCAGCCCAGCCCTGTCCAGCCCGGTTCCCGG
HKR376057 RBd40C09 pGCAP10 NM_007278.1  
GGCTGCACCGCGTGTACAAAGACAAAGAGATGAATCTGGGGTAGATTTAGGTGCTAGGAA
HKR390032 RBd75B08 pGCAP10 NM_007278.1  
TGAGGATCTCTGGGACTCAGTGCTGCACCGCGTGTACAAAGACAAAGAGATGAATCTGGG
HKR409059 RBdS022K19 pGCAP10 NM_007278.1  
GATCTCTGGGACTCAGTGCTGCACCGCGTGTACAAAGACAAAGAGATGAATCTGGGGTAG
HKR442158 RBdS105G14 pGCAP10 NM_007278.1  
GGAATAGGGAAGTGGCGCAAATTCGTGGATCGCTCCGCTGAATCCGCCCGCGCGTCGCCG
HKR462739 RBdS156O03 pGCAP10 NM_007278.1  
GCCAGCCCTGTCCAGCCCGGTTCCCGGGAGGATGAAGTTCGTGTACAAAGAAGAGCATCC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2018.05.24

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_180123.pl