Prev. |  KEGG KO K11586 > 

RIKEN DNA Bank Human Resource - CBX3

Gene ID NCBI Gene 11335 |  KEGG hsa:11335
Gene Symbol CBX3
Protein Name chromobox 3
Synonyms HECH|HP1-GAMMA|HP1Hs-gamma
Ortholog resources KEGG ortholog (KEGG orthology K11586) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX001476 IRAK003L12 pCMV-SPORT6 BC000954 NM_016587 Full
HGY092705 IRAL031M17 pDNR-LIB BC014380 NM_016587 Partial/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE028605 W01A071I13 pENTR-TOPO IRAK003L12 BC000954 NM_016587  
HGE028607 W01A071I15 pENTR-TOPO IRAK003L12 BC000954 NM_016587  
HGE028613 W01A071I21 pENTR-TOPO IRAK003L12 BC000954 NM_016587 done

♦ W series clone contains a stop codon.

GNP_entry_W01A_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR165212 ARi13A12 pGCAP10 NM_007276.3  
GAGACGCTGCAGACCCGCGACCCGGAGCAGCTCGGAGGCGGTGAATAATAGCTCTTCAAG
HKR235300 ARiS088E04 pGCAP10 NM_007276.3  
GCCCCCTTCGGATGTGGCTTGAGCTGTAGGCGCGGAGGGCCGGAGACGCTGCAGACCCGC
HKR277746 ARiS194G02 pGCAP10 NM_007276.3  
TGGGATGTGGCTTGAGCTGTAGGCGCGGAGGGCCGGAGACGCTGCAGACCCGCGACCCGG
HKR321206 RBb03A06 pKA1U5 NM_007276.3  
GGNNTCTCNNNCGGCNGACGGCCTCCCCNNNCGNTNCCGNGCTCNCTCCCCCTTNATATN
HKR321370 RBb03H02 pKA1U5 NM_007276.3  
GGGAGACGCTGCAGACCCGCGACCCGGAGCAGCTCGNAGGCGGTGAATAATAGCTCTTCA
HKR322575 RBb06H07 pKA1U5 NM_007276.3  
GCCCCTTCGGATGTGGCTTGAGCTGTAGGCGCGGAGGGCCGGAGACGCTGCAGACCCGCG
HKR326849 RBb17C01 pKA1U5 NM_007276.3  
HKR327232 RBb18B08 pKA1U5 NM_007276.3  
GGGATGTGGCTTGAGCTGTAGGCGCGGAGGGCCGGAGACGCTGCAGACCCGCGACCCGGA
HKR331257 RBb28C09 pGCAP1 NM_007276.3  
GTCCCGGCTCCCTCCCCCTTCGGATGTGGCTTGAGCTGTAGGCGCGGAGGGCCGGAGACG
HKR334005 RBb35A05 pGCAP1 NM_007276.3  
AATGTGGGTGGCTTGAGCTGTAGGCGCGGAGGGCCGGAGACGCTGCAGACCCGCGACCCG
HKR334554 RBb36G10 pGCAP1 NM_007276.3  
TGGAGGGCTTGAGCTGTAGGCGCGGAGGGCCGGAGACGCTGCAGACCCGCGACCCGGAGC
HKR335378 RBb38H10 pGCAP1 NM_007276.3  
GCCCTTCGGATGTGGCTTGAGCTGTAGGCGCGGAGGGCCGGAGACGCTGCAGACCCGCGA
HKR345280 RBb63D08 pGCAP1 NM_007276.3  
GCTTCGGATGTGGCTTGAGCTGTAGGCGCGGAGGGCCGGAGACGCTGCAGACCCGCGACC
HKR361610 RBd04A10 pGCAP10 NM_007276.3  
GGGAGACGCTGCAGACCCGCGACCCGGAGCAGCTCGGAGGCGGTGAATAATAGCTCTTCA
HKR365250 RBd13C02 pGCAP10 NM_007276.3  
GAGACGCTGCAGACCCGCGACCCGGAGCAGCTCGGAGGCGGTGAATAATAGCTCTTCAAG
HKR368949 RBd22G05 pGCAP10 NM_007276.3  
GGGAGACGCTGCAGACCCGCGACCCGGAGCAGCTCGGAGGCGGTGAATAATAGCTCTTCA
HKR370508 RBd26E12 pGCAP10 NM_007276.3  
GGCTTGAGCTGTAGGCGCGGAGGGCCGGAGACGCTGCAGACCCGCGACCCGGAGCAGCTC
HKR371257 RBd28C09 pGCAP10 NM_007276.3  
GCGGCGTGGGCGGTGCCACCCCTCCCCCCGGCGGCCCCGCGCGCAGCTCCCGGCTCCCTC
HKR371325 RBd28F05 pGCAP10 NM_007276.3  
GGGAGACGCTGCAGACCCGCGACCCGGAGCAGCTCGGAGGCGGTGAATAATAGCTCTTCA
HKR372497 RBd31E01 pGCAP10 NM_007276.3  
GGGATGTGGCTTGAGCTGTAGGCGCGGAGGGCCGGAGACGCTGCAGACCCGCGACCCGGA
HKR384003 RBd60A03 pGCAP10 NM_007276.3  
GGGATGTGGCTTGAGCTGTAGGCGCGGAGGGCCGGAGACGCTGCAGACCCGCGACCCGGA
HKR386449 RBd66C01 pGCAP10 NM_007276.3  
GGCAGACCCGCGACCCGGAGCAGCTCGGAGGCGGTGAATAATAGCTCTTCAAGTCTGCAA
HKR386856 RBd67C08 pGCAP10 NM_007276.3  
GCTCTCCCCCTTCGGATGTGGCTTGAGCTGTAGGCGCGGAGGGCCGGAGACGCTGCAGAC
HKR389210 RBd73A10 pGCAP10 NM_007276.3  
GGGATGTGGCTTGAGCTGTAGGCGCGGAGGGCCGGAGACGCTGCAGACCCGCGACCCGGA
HKR389284 RBd73D12 pGCAP10 NM_007276.3  
GGTAGGCGCGGAGGGCCGGAGACGCTGCAGACCCGCGACCCGGAGCAGCTCGGAGGCGGT
HKR405827 RBdS014J11 pGCAP10 NM_007276.3  
GCCCCTTCGGATGTGGCTTGAGCTGTAGGCGCGGAGGGCCGGAGACGCTGCAGACCCGCG
HKR430238 RBdS075J22 pGCAP10 NM_007276.3  
GGGAGACGCTGCAGACCCGCGACCCGGAGCAGCTCGGAGGCGGTGAAGTCGGTGGCTTTC
HKR432652 RBdS081K12 pGCAP10 NM_007276.3  
GGTAGGCGCGGAGGGCCGGAGACGCTGCAGACCCGCGACCCGGAGCAGCTCGGAGGCGGT
HKR433533 RBdS083N21 pGCAP10 NM_007276.3  
GGCGCAGCTCCCGGCTCCCTCCCCCTTCGGATGTGGCTTGAGCTGNANGCGCGGAGGGCC
HKR441762 RBdS104G18 pGCAP10 NM_007276.3  
GGTAGGNGCGGAGGGCCGGAGACGCTGCAGACCCGCGACCCGGAGCAGCTCGGAGGCGGT
HKR462460 RBdS156C12 pGCAP10 NM_007276.3  
GGCAGACCCGCGACCCGGAGCAGCTCGGAGGCGGTGAATAATAGCTCTTCAAGTCTGCAA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2020.08.05

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl