Prev. | 

RIKEN DNA Bank Human Resource - TUSC2

Gene ID NCBI Gene 11334 |  KEGG hsa:11334
Gene Symbol TUSC2
Protein Name tumor suppressor 2, mitochondrial calcium regulator
Synonyms C3orf11|FUS1|PAP|PDAP2
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY082825 IRAL007B01 pOTB7 BC023976 NM_007275 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR174079 ARi35D07 pGCAP10 NM_007275.1  
GAGGCGGCGGCGGCGGCACCTGCGATCAGCGGCTGGGGCAGGTTATGGTAGTGCGGACTG
HKR185747 ARi64G03 pGCAP10 NM_007275.1  
HKR321349 RBb03G05 pKA1U5 NM_007275.1  
GAAGGCGGCGGCGGCGGCACCTGCGATCAGCGNCTGTNGCAGGTTATGGTAGTGCGGACT
HKR368482 RBd21D10 pGCAP10 NM_007275.1  
GGTTTCCGTGGAGACAGCCGAGCCTGCGGAAGGCGGCGGCGGCGGCACCTGCGATCAGCG
HKR428366 RBdS070P06 pGCAP10 NM_007275.1  
GGGCACCTGCGATCAGCGGCTGGGGCAGGTTATGGTAGTGCGGACTGCGGTGTGAGCAGA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl