Prev. |  KEGG KO K09575 > 

RIKEN DNA Bank Human Resource - FKBP9

Gene ID NCBI Gene 11328 |  KEGG hsa:11328
Gene Symbol FKBP9
Protein Name FKBP prolyl isomerase 9
Synonyms FKBP60|FKBP63|PPIase
Ortholog resource in our bank

  FKBP9

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX055894 IRAK139M06 pCMV-SPORT6 BC064418 NM_007270 Partial
HGY084327 IRAL010N15 pOTB7 BC007443 NM_007270 Partial

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE085214 M01C013A14 pDONR221 FLJ04-B07 AK075331 NM_007270  
HGE085262 M01C013C14 pDONR221 FLJ04-B07 AK075331 NM_007270  
HGE085310 M01C013E14 pDONR221 FLJ04-B07 AK075331 NM_007270  
HGE085358 M01C013G14 pDONR221 FLJ04-B07 AK075331 NM_007270  
HGE085406 M01C013I14 pDONR221 FLJ04-B07 AK075331 NM_007270  
HGE085454 M01C013K14 pDONR221 FLJ04-B07 AK075331 NM_007270  
HGE085502 M01C013M14 pDONR221 FLJ04-B07 AK075331 NM_007270  
HGE085550 M01C013O14 pDONR221 FLJ04-B07 AK075331 NM_007270  
HGE085216 M01C013A16 pDONR221 FLJ04-B08 AK075331 NM_007270  
HGE085264 M01C013C16 pDONR221 FLJ04-B08 AK075331 NM_007270  
HGE085312 M01C013E16 pDONR221 FLJ04-B08 AK075331 NM_007270  
HGE085360 M01C013G16 pDONR221 FLJ04-B08 AK075331 NM_007270  
HGE085408 M01C013I16 pDONR221 FLJ04-B08 AK075331 NM_007270  
HGE085456 M01C013K16 pDONR221 FLJ04-B08 AK075331 NM_007270  
HGE085504 M01C013M16 pDONR221 FLJ04-B08 AK075331 NM_007270  
HGE085552 M01C013O16 pDONR221 FLJ04-B08 AK075331 NM_007270  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR249046 ARiS122K06 pGCAP10 NM_007270.2  
GCCCCTGGAGCTGCAGCCGGGAGGGCGGGCGGCCGGGGAGACGGGGTGGCGGCTGCAGCC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl