Prev. |  KEGG KO K12835 > 

RIKEN DNA Bank Human Resource - DDX42

Gene ID NCBI Gene 11325 |  KEGG hsa:11325
Gene Symbol DDX42
Protein Name DEAD-box helicase 42
Synonyms DDX42P|RHELP|RNAHP|SF3B8|SF3b125
Ortholog resource in our bank

  DDX42

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX005407 IRAK013I15 pCMV-SPORT6 BC008208 NM_203499 Partial
HGX005983 IRAK014P23 pCMV-SPORT6 BC015505 NM_203499 Partial
HGY103413 IRAL058I21 pOTB7 BC078667 NM_203499 Partial

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR340803 RBb52A03 pGCAP1 NM_203499.1  
AGCTGCCGCTGCAGCCATAGCANCAGGTCAGTCATTGGCACCATGAACTGGAATAAAGGT
HKR370031 RBd25B07 pGCAP10 NM_203499.1  
ACCCCTCCCCCCTTCAGCAACGGGCCGTGAGGCGGTGGCGGTGGTGGCGGTGGCGGTGGC
HKR386921 RBd67F01 pGCAP10 NM_203499.1  
GTCCCCCCTTCAGCAACGGGCCGTGAGGCGGTGGCGGTGGTGGCGGTGGCGGTGGCGGTG
HKR388877 RBd72D05 pGCAP10 NM_203499.1  
GCCTTCAGCAACGGGCCGTGAGGCGGTGGCGGTGGTGGCGGTGGCGGCGGCGGTGGTGGT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl