Prev. |  KEGG KO K06883 > 

RIKEN DNA Bank Human Resource - GPN1

Gene ID NCBI Gene 11321 |  KEGG hsa:11321
Gene Symbol GPN1
Protein Name GPN-loop GTPase 1
Synonyms ATPBD1A|MBDIN|NTPBP|RPAP4|XAB1
Ortholog resources KEGG ortholog (KEGG orthology K06883) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY084322 IRAL010N10 pOTB7 BC007451 NM_007266 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR066875 ARe67D03 pKA1U5 NM_007266.2  
GAGGAGGAAGATGGCGGCGTCCGCAGCTGCCGCTGAGCTCCAGGCTTCTGGGGGTCCGCG
HKR399257 RBd98C09 pGCAP10 NM_007266.2  
GATGGTCGGGTGGGTGGGGCCAGGAGGAAGATGGCGGCGTCCGCAGCTGCCGCTGAGCTC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.20

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl