Prev. |  KEGG KO K17268 > 

RIKEN DNA Bank Human Resource - COPE

Gene ID NCBI Gene 11316 |  KEGG hsa:11316
Gene Symbol COPE
Protein Name coatomer protein complex subunit epsilon
Synonyms epsilon-COP
Ortholog resources KEGG ortholog (KEGG orthology K17268) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY083682 IRAL009D10 pOTB7 BC003155 NM_007263 Full
HGY088897 IRAL022E01 pOTB7 BC007250 NM_007263 Full
HGY095812 IRAL039I20 pOTB7 BC017285 NM_007263 Full
HGY099116 IRAL047N04 pOTB7 BC052619 NM_007263 Partial/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR067208 ARe68A08 pKA1U5 NM_007263.3  
GGTGTCTTTCAGGAAGAGGAGCTGGTGAGAAGACAGCGAAATGGCGCCTCCGGCCCCCGG
HKR238402 ARiS096A02 pGCAP10 NM_007263.3  
TTTTTTTTTTTTGAGGAAGAGGAGCTGGTGAGAAGACAGCGAAATGGCGCCTCCGGCCCC
HKR322034 RBb05B10 pKA1U5 NM_007263.3  
GGAGCTGGTGAGAAGACAGCGAAATGGCGCCTCCGGCCCCCGGCCCGGCCTCCGGCGGCT
HKR375380 RBd38H12 pGCAP10 NM_007263.3  
GAGGAAGAGGAGCTGGTGAGAAGACAGCGAAATGGCGCCTCCGGCCCCCGGCCCGGCCTC
HKR442057 RBdS105C09 pGCAP10 NM_007263.3  
GGTGTCTTTCAGGAAGAGGAGCTGGTGAGAAGACAGCGAAATGGCGCCTCCGGCCCCCGG
HKR444250 RBdS110K10 pGCAP10 NM_007263.3  
GAAGACAGCGAAATGGCGCCTCCGGCCCCCGGCCCGGCCTCCGGCGGCTCCGGGGAGGTA
HKR470845 RBdS177B21 pGCAP10 NM_007263.3  
GGGTGAGAAGACAGCGAAATGGCGCCTCCGGCCCCCGGCCCGGCCTCCGGCGGCTCCGGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.20

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl