Prev. |  KEGG KO K05687 > 

RIKEN DNA Bank Human Resource - PARK7

Gene ID NCBI Gene 11315 |  KEGG hsa:11315
Gene Symbol PARK7
Protein Name Parkinsonism associated deglycase
Synonyms DJ-1|DJ1|GATD2|HEL-S-67p
Ortholog resources KEGG ortholog (KEGG orthology K05687) in the DNA Bank
Featured content Parkinson disease - human
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Individualy Deposited Resource

Catalog number Name of Resource Description
RDB01946 pEF-DJ-1-HA Human DJ-1 cDNA

RDB_org_190226.csv


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX001223 IRAK003A23 pCMV-SPORT6 BC008188 NM_007262

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR040826 ARe02B02 pKA1U5 NM_007262.4  
GACTTTCAGCCTGGTGTGGGGTGAGTGGTACCCAACGGGCCGGGGCGCCGCGTCCGCAGG
HKR044857 ARe12C09 pKA1U5 NM_007262.4  
GGCGTTTCACTTTCAGCCTGGTGTGGGGCTTGTAAACATATAACATAAAAATGGCTTCCA
HKR056457 ARe41C09 pKA1U5 NM_007262.4  
GACTTTCAGCCTGGTGTGGGGCTTGTAAACATATAACATAAAAATGGCTTCCAAAAGAGC
HKR065651 ARe64C03 pKA1U5 NM_007262.4  
ACCCAACGGGCCGGGGCGCCGCGTCCGCAGGAAGAGGCGCGGGGTGCAGGCTTGTAAAC
HKR072006 ARe80A06 pKA1U5 NM_007262.4  
GGTGTGGGGCTGAGGGAGGCCGGACGGCGCGCGTGCGTGCTGGCGTGCGTTCACTTTCAG
HKR170577 ARi26H09 pGCAP10 NM_007262.4  
CGGCCGGCCGATGGAGGGAGGCCGGACGGCGCGCGTGCGTGCTGGCGTGCATTCACTTGC
HKR235104 ARiS087M16 pGCAP10 NM_007262.4  
GAGTGNGNGGCTGAGGGAGGCCGGACGGCGCGCGTGCGTGCTGGCGTGCGTTCACTTTCA
HKR323660 RBb09C12 pKA1U5 NM_007262.4  
GACTTTCAGCCTGGTGTGGGGTGAGTGGTACCCAACGGGCCGGGGCGCCGCGTCCGCAGG
HKR361299 RBd03E03 pGCAP10 NM_007262.4  
GCTGCGCAGTGTGGGGCTGAGGGAGGCCGGACGGCGCGCGTGCGTGCTGGCGTGCGTTCA
HKR364902 RBd12E06 pGCAP10 NM_007262.4  
CGGCCGGCCGATGACCCAACGGGCCGGGGCGCCGCGTCCGCAGGAAGAGGCGCGGGGTGC
HKR378880 RBd47D08 pGCAP10 NM_007262.4  
GGAGGGAGGCCGGACGGCGCGCGTGCGTGCTGGCGTGCGTTCACTTTCAGCCTGGTGTGG
HKR387281 RBd68D09 pGCAP10 NM_007262.4  
GAGGCCGGACGGCGCGCGTGCGTGCTGGCGTGCGTTCACTTTCAGCCTGGTGTGGGGCTT
HKR396003 RBd90A03 pGCAP10 NM_007262.4  
GCTGGTGTGGGGTGAGTGGTACCCAACGGGCCGGGGCGCCGCGTCCGCAGGAAGAGGCGC
HKR405285 RBdS013D13 pGCAP10 NM_007262.4  
GGCGTTCACTTTCAGCCTGGTGTGGGGCTTGTAAACATATAACATAAAAATGGCTTCCAA
HKR428381 RBdS070P21 pGCAP10 NM_007262.4  
GACTTTCAGCCTGGTGTGGGGCTTGTAAACATATAACATAAAAATGGCTTCCAAAAGAGC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.05.17

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_190501.pl