Prev. |  KEGG KO K10443 > 

RIKEN DNA Bank Human Resource - KLHL2

Gene ID NCBI Gene 11275 |  KEGG hsa:11275
Gene Symbol KLHL2
Protein Name kelch like family member 2
Synonyms ABP-KELCH|MAV|MAYVEN
Ortholog resources KEGG ortholog (KEGG orthology K10443) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY018457 IRAK046C09 pBluescriptR BC036468 NM_007246 Full/var
HGY012812 IRAK032A12 pBluescriptR BC022503 NM_007246

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR461800 RBdS154I08 pGCAP10 NM_007246.2 done
GGCGCCCGGCCGAGCGGGCCATGGCCGCGGGGGCCGCCGCCGCAGGTGGTGGCGCGCGGT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_210404.csv
NRCDhumcloneList_RB_210404.csv


2021.04.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_210329.pl