Prev. |  KEGG KO K12188 > 

RIKEN DNA Bank Human Resource - SNF8

Gene ID NCBI Gene 11267 |  KEGG hsa:11267
Gene Symbol SNF8
Protein Name SNF8, ESCRT-II complex subunit
Synonyms Dot3|EAP30|VPS22
Ortholog resources KEGG ortholog (KEGG orthology K12188) in the DNA Bank
Featured content Endocytosis (human)
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX004810 IRAK012A10 pCMV-SPORT6 BC008976 NM_007241
HGX032809 IRAK082A09 pCMV-SPORT6 BC038830 NM_007241 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR172123 ARi30F03 pGCAP10 NM_007241.2  
GCGCCTTGGGGAGCCGGCGGCGGAGTCCGGGACGTGGAGACCCGGGGTCCCGGCAGCCGG
HKR188532 ARi71F12 pGCAP10 NM_007241.2  
GGCCGGCGGCGGAGTCCGGGACGTGGAGACCCGGGGTCCCGGCAGCCGGGCGGCCCGCGG
HKR234042 ARiS085B18 pGCAP10 NM_007241.2  
GGGCTTCCGCCTTGGGGAGCCGGCGGCGGAGTCCGGGACGTGGAGACCCGGGGTCCCGGC
HKR333203 RBb33A03 pGCAP1 NM_007241.2  
GGGAGTCCGGGCACGTTGTTAGACCCGGGGTCCCGGCAGCCCCTNCAANAANGCGGGCCC
HKR338456 RBb46C08 pGCAP1 NM_007241.2  
TGGGANTNCGGNACGTGGCANACCCGGGGTTCCCGGCAGCCGGGCGGCCCGCGGGCCCAG
HKR342974 RBb57H06 pGCAP1 NM_007241.2  
GGGGGAGCCGGCGGCGGAGTCCGGGACGTGGAGACCCGGGGTCCCGGCAGCCGGGCGGCC
HKR344809 RBb62A09 pGCAP1 NM_007241.2  
GGCCCGCGGGCCCAGGGTGGGGATGCACCGCCGCGGGGTGGGAGCTGGCGCCATCGCCAG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.20

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl