Prev. |  KEGG KO K14819 > 

RIKEN DNA Bank Human Resource - DUSP12

Gene ID NCBI Gene 11266 |  KEGG hsa:11266
Gene Symbol DUSP12
Protein Name dual specificity phosphatase 12
Synonyms DUSP1|YVH1
Ortholog resource in our bank

  DUSP12

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Individualy Deposited Resource

Catalog number Name of Resource Description
RDB07384 pGL4-phDUSP12 Promoter collection, Human DUSP12 promoter

webcatalog20220516.tab


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY086176 IRAL015H08 pOTB7 BC006286 NM_007240 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Jun29.csv
GNP_full_IRAL_2023Jun29.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE037601 W01A094A01 pENTR-TOPO IRAL015H08 BC006286 NM_007240  
HGE037603 W01A094A03 pENTR-TOPO IRAL015H08 BC006286 NM_007240  
HGE037605 W01A094A05 pENTR-TOPO IRAL015H08 BC006286 NM_007240  
HGE037609 W01A094A09 pENTR-TOPO IRAL015H08 BC006286 NM_007240  
HGE037611 W01A094A11 pENTR-TOPO IRAL015H08 BC006286 NM_007240  
HGE037615 W01A094A15 pENTR-TOPO IRAL015H08 BC006286 NM_007240  
HGE047147 W01A117O11 pENTR-TOPO IRAL015H08 BC006286 NM_007240  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR189377 ARi73H09 pGCAP10 NM_007240.1  
GGGGCGCGGCCATGTTGGAGGCTCCGGGCCCGAGTGATGGCTGCGAGCTCAGCAACCCCA
HKR402869 RBdS007C21 pGCAP10 NM_007240.1  
GGTTGGAGGCTCCGGGCCCGAGTGATGGCTGCGAGCTCAGCAACCCCAGCGCCAGCAGAG
HKR405802 RBdS014I10 pGCAP10 NM_007240.1  
GGTCTCTGGGCGCGGCCATGTTGGAGGCTCCGGGCCCGAGTGATGGCTGCGAGCTCAGCA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.10.11

Homo_sapiens_gene_info230514.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl