DNA Bank Top |  KEGG KO K14819 > 

RIKEN DNA Bank Human Resource - DUSP12

Gene ID NCBI Gene 11266 |  KEGG hsa:11266
Gene Symbol DUSP12
Protein Name dual specificity phosphatase 12
Synonyms DUSP1|YVH1

Link

Ortholog resource in our bank

  DUSP12


External database

human DUSP12

Individualy Deposited Resource

Catalog number Name of Resource Description CDS comparison
Refered (NCBI mRNA) CDS status(1)
RDB07384 pGL4-phDUSP12 Promoter collection, Human DUSP12 promoter    

(1) CDS status was determined by comparing the plasmid sequence with NCBI RefSeq mRNA.

webcatalog20240727.tab


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY086176 IRAL015H08 pOTB7 BC006286 NM_007240 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the plasmid sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2024May11.csv
GNP_full_IRAL_2024May11.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE037601 W01A094A01 pENTR-TOPO IRAL015H08 BC006286 NM_007240  
HGE037603 W01A094A03 pENTR-TOPO IRAL015H08 BC006286 NM_007240  
HGE037605 W01A094A05 pENTR-TOPO IRAL015H08 BC006286 NM_007240  
HGE037609 W01A094A09 pENTR-TOPO IRAL015H08 BC006286 NM_007240  
HGE037611 W01A094A11 pENTR-TOPO IRAL015H08 BC006286 NM_007240  
HGE037615 W01A094A15 pENTR-TOPO IRAL015H08 BC006286 NM_007240  
HGE047147 W01A117O11 pENTR-TOPO IRAL015H08 BC006286 NM_007240  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2024May11.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR189377 ARi73H09 pGCAP10 NM_007240.1  
GGGGCGCGGCCATGTTGGAGGCTCCGGGCCCGAGTGATGGCTGCGAGCTCAGCAACCCCA
HKR402869 RBdS007C21 pGCAP10 NM_007240.1  
GGTTGGAGGCTCCGGGCCCGAGTGATGGCTGCGAGCTCAGCAACCCCAGCGCCAGCAGAG
HKR405802 RBdS014I10 pGCAP10 NM_007240.1  
GGTCTCTGGGCGCGGCCATGTTGGAGGCTCCGGGCCCGAGTGATGGCTGCGAGCTCAGCA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2024May11.csv
NRCDhumcloneList_RB_2024May11.csv


No Approval Forms Required for Fluorescent Protein Genes Developed by Dr. Atsushi Miyawaki
♦ RIKEN BRC will be closed from December 28, 2024 through January 5, 2025 due to New Year's holidays.
A bicistronic cell cycle reporter, Fucci2a (Sep 17, 2024)
Monomeric Fluorescent Protein Resource, mStayGold (Dec 18, 2023)
Visualization of Organelles update (Dec 18, 2023)
Development of two mouse strains conditionally expressing bright luciferases (Sep 08, 2023)
Autophagy and Mitophagy Updates (Aug 16, 2023)
High intensity forms of luciferase and luminescent proteins from various organisms (BRC RESOURCE NEWS) (Apr 28, 2023)
Plasmid of Cas9 expression/mRNA production, evaluation of the genome edit efficiency, and Knock-in donors and tags
Fucci cell cycle indicator, Calcium sensor and Fluorescent and Luminescent protein resources
Revision of Distribution Fees for Bioresources in RIKEN BRC
- - - - - - - - - - - - - - - - - - - -
Mail News sign-up. Receive information of the forcusd resources, new available resources and more.
♦ Please visit "Terms of Use", "Quality control" and "Ordering instruction"
Dnaconda's recommendation BRC Resource News RIKEN BRC 20th RIKEN BRC News sign-up

2024.09.25

Homo_sapiens_gene_info230514.csv - RDB_hum_GIxxxxxxxxx_html_240727.pl