Prev. |  KEGG KO K14288 > 

RIKEN DNA Bank Human Resource - XPOT

Gene ID NCBI Gene 11260 |  KEGG hsa:11260
Gene Symbol XPOT
Protein Name exportin for tRNA
Synonyms XPO3
Ortholog resource in our bank

  XPOT

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX001552 IRAK003O16 pCMV-SPORT6 BC000950 NM_007235 Partial
HGX011026 IRAK027J10 pCMV-SPORT6 BC020569 NM_007235 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR175770 ARi39H02 pGCAP10 NM_007235.3  
GCTGCCCGGCGCCACGCAAGAGAAGGTGCCAGGGGACGCAGAGCGACTAGAGGCGCGCGG
HKR325326 RBb13F06 pKA1U5 NM_007235.3  
GAAGGTGCCAGGGGACGCAGAGCGACTAGAGGCGCGCGGTCCCGGCCAGCACCGTCTCTG
HKR370101 RBd25E05 pGCAP10 NM_007235.3  
GGACTGTTCCCGCGGGGACCCCGCCCGCGCCCGCTCCTGCTGGCGGCGCGTCGATAATCC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl