Prev. |  KEGG KO K10425 > 

RIKEN DNA Bank Human Resource - DCTN3

Gene ID NCBI Gene 11258 |  KEGG hsa:11258
Gene Symbol DCTN3
Protein Name dynactin subunit 3
Synonyms DCTN-22|DCTN22
Ortholog resource in our bank

  DCTN3

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY080549 IRAL001G05 pOTB7 BC000319 NM_024348 Full
HGY083633 IRAL009B09 pOTB7 BC003004 NM_024348 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR053321 ARe33F01 pKA1U5 NM_007234.3  
GGTTTCCTGGCCGAGGTGGGTCGGTAGTAGCGATGGCGGGTCTGACTGACTTGCAGCGGC
HKR058854 ARe47C06 pKA1U5 NM_007234.3  
GCCTGGCCGAGGTGGGTCGGTAGTAGCGATGGCGGGTCTGACTGACTTGCAGCGGCTACA
HKR076002 ARe90A02 pKA1U5 NM_007234.3  
NGGTCGGTAGTAGCGANGGCGGGTCTGACTGACTTGCAGCGGCTACAGGCCCGAGTGGAA
HKR177726 ARi44F06 pGCAP10 NM_007234.3  
GGAGGTGGGTCGGTAGTAGCGATGGCGGGTCTGACTGACTTGCAGCGGCTACAGGCCCGA
HKR420681 RBdS051L17 pGCAP10 NM_007234.3  
GTTTCCTGGCCGAGGTGGGTCGGTAGTAGCGATGGCGGGTCTGACTGACTTGCAGCGGCT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl