Prev. |  KEGG KO K04151 > 

RIKEN DNA Bank Human Resource - HRH3

Gene ID NCBI Gene 11255 |  KEGG hsa:11255
Gene Symbol HRH3
Protein Name histamine receptor H3
Synonyms GPCR97|HH3R
Ortholog resource in our bank

  HRH3

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR320979 RBb02H11 pKA1U5 NM_007232.2 done
GACGGTCGCACCGGCAGCGGCTCAGGCTCCGGCTCCTCTCCCGCTGCAGCAGCCGCGCTG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2022Apr03.csv
NRCDhumcloneList_RB_2022Apr03.csv


2022.04.04

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_220215.pl