RIKEN DNA Bank Human Resource

RIKEN DNA Bank Human Resource - HRH3

Gene ID	NCBI Gene 11255 \| KEGG hsa:11255
Gene Symbol	HRH3
Protein Name	histamine receptor H3
Synonyms	GPCR97\|HH3R

Ortholog resource in our bank

  HRH3

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number	Clone name	Vector	CDS comparison
	Clone name	Vector	Refered mRNA⁽¹⁾	CDS status
	5'-terminal sequence⁽²⁾
HKR320979	RBb02H11	pKA1U5	NM_007232.2	Full
HKR320979	GACGGTCGCACCGGCAGCGGCTCAGGCTCCGGCTCCTCTCCCGCTGCAGCAGCCGCGCTG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.10

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl