Prev. |  KEGG KO K09540 > 

RIKEN DNA Bank Human Resource - SEC63

Gene ID NCBI Gene 11231 |  KEGG hsa:11231
Gene Symbol SEC63
Protein Name SEC63 homolog, protein translocation regulator
Synonyms DNAJC23|ERdj2|PCLD2|PRO2507|SEC63L
Ortholog resource in our bank

  SEC63

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Individualy Deposited Resource

Catalog number Name of Resource Description
RDB16048 Sec63N-V5-GFP11 The split-GFP system clone for visualizing organelle contact sites in mammalian cells. probe: V5-GFP11; location: endoplasmic reticulum.

webcatalog20220516.tab


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX037427 IRAK093J11 pCMV-SPORT6 BC048287 NM_007214 Full/var
HGY042700 IRAK106M12 pBluescript BC047221 NM_007214 Full
HGY082738 IRAL006O02 pOTB7 BC001153 NM_007214 Partial/var
HGY093228 IRAL033B04 pOTB7 BC023598 NM_007214 Partial/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR362103 RBd05E07 pGCAP10 NM_007214.4  
GAGCGGCAGAGGTGGCGGCGGCGTGTCCGTGAGAGTGGCGTGGGGGCGGGGAGGAGAGGC
HKR409100 RBdS022M12 pGCAP10 NM_007214.4  
GCTCCTCTCGCGAGAGCTGGCGACGGCGGCGGCAGCGGCAGAGGTGGCGGCGGCGTGTCC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023Apr25.csv
NRCDhumcloneList_RB_2023Apr25.csv


2023.05.01

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_220215.pl