Prev. |  KEGG KO K02906 > 

RIKEN DNA Bank Human Resource - MRPL3

Gene ID NCBI Gene 11222 |  KEGG hsa:11222
Gene Symbol MRPL3
Protein Name mitochondrial ribosomal protein L3
Synonyms COXPD9|MRL3|RPML3
Ortholog resource in our bank

  MRPL3

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX001463 IRAK003K23 pCMV-SPORT6 BC003375 NM_007208 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR218106 ARiS045E10 pGCAP10 NM_007208.2  
AGAGAGCNTCGGCCGGCGACCGTTCCGGCGGCCATTGCGAAAACTTCCCCACGGCTACTG
HKR279443 ARiS198K03 pGCAP10 NM_007208.2  
HKR461722 RBdS154F02 pGCAP10 NM_007208.2  
GCCGGCGGCTTTCTTTCCGTCGCAGAGAGCATCGGCCGGCGACCGTTCCGGCGGCCATTG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl