Prev. |  KEGG KO K13131 > 

RIKEN DNA Bank Human Resource - DDX20

Gene ID NCBI Gene 11218 |  KEGG hsa:11218
Gene Symbol DDX20
Protein Name DEAD-box helicase 20
Synonyms DP103|GEMIN3
Ortholog resource in our bank

  DDX20

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY013369 IRAK033H01 pBluescriptR BC034953 NM_007204 Full/var
HGY019335 IRAK048F15 pBluescriptR BC031062 NM_007204 Full/var
HGY091944 IRAL029O08 pOTB7 BC011556 NM_007204 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE025820 W01A064J04 pENTR-TOPO flj0034g22 AK001506 NM_007204  
HGE025822 W01A064J06 pENTR-TOPO flj0034g22 AK001506 NM_007204  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR384924 RBd62F04 pGCAP10 NM_007204.3  
GAGTTGCCTCATCTTTCCTCTCCTCCCTCTTGGGGCTTTCCTCAGGCCACATTTTTTGTG
HKR428237 RBdS070J21 pGCAP10 NM_007204.3  
GGATCTGACGGCGCGGCTACCATGGCGGCGGCATTTGAAGCCTCGGGAGCCTTAGCAGCA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl