Prev. |  KEGG KO K03510 > 

RIKEN DNA Bank Human Resource - POLI

Gene ID NCBI Gene 11201 |  KEGG hsa:11201
Gene Symbol POLI
Protein Name DNA polymerase iota
Synonyms RAD30B|RAD3OB|eta2
Ortholog resources KEGG ortholog (KEGG orthology K03510) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX027837 IRAK069J21 pCMV-SPORT6 BC032662 NM_007195 Full/var
HGX027910 IRAK069M22 pCMV-SPORT6 BC032617 NM_007195 Partial/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE094041 M01C035B17 pDONR221 MGC07-C09 BC032662 ENST00000217800  
HGE094089 M01C035D17 pDONR221 MGC07-C09 BC032662 ENST00000217800  
HGE094137 M01C035F17 pDONR221 MGC07-C09 BC032662 ENST00000217800  
HGE094185 M01C035H17 pDONR221 MGC07-C09 BC032662 ENST00000217800  
HGE094233 M01C035J17 pDONR221 MGC07-C09 BC032662 ENST00000217800  
HGE094281 M01C035L17 pDONR221 MGC07-C09 BC032662 ENST00000217800  
HGE094329 M01C035N17 pDONR221 MGC07-C09 BC032662 ENST00000217800  
HGE094377 M01C035P17 pDONR221 MGC07-C09 BC032662 ENST00000217800  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR348035 RBb70B11 pGCAP1 NM_007195.2  
GGGCGGCGGCGACGACGACGAAGGAAGACGCCGAAGGCCTGGGCCATGGAACTGGCGGAC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.20

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl