Prev. | 

RIKEN DNA Bank Human Resource - SEC23IP

Gene ID NCBI Gene 11196 |  KEGG hsa:11196
Gene Symbol SEC23IP
Protein Name SEC23 interacting protein
Synonyms MSTP053|P125|P125A
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX056652 IRAK141K12 pCMV-SPORT6 BC063800 NM_007190 Full
HGY081641 IRAL004B17 pOTB7 BC002540 NM_007190 Partial/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR324478 RBb11D06 pKA1U5 NM_007190.2  
GAGTGGTGTGGTACCGGGTACCCGGAGACGTGTATCGGACGGTGGGCCGCAGCCATGGCC
HKR442296 RBdS105M08 pGCAP10 NM_007190.2  
TGAGGAGCGTGATCGGTTTCCGGTCAGTGGTGTGGTACCGGGTACCCGGAGACGTGTATC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl