Prev. |  KEGG KO K13220 > 

RIKEN DNA Bank Human Resource - WBP4

Gene ID NCBI Gene 11193 |  KEGG hsa:11193
Gene Symbol WBP4
Protein Name WW domain binding protein 4
Synonyms FBP21
Ortholog resource in our bank

  WBP4

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE017861 W01A044K21 pENTR-TOPO flj0034p21 AK001557 NM_007187  
HGE017891 W01A044M03 pENTR-TOPO flj0034p21 AK001557 NM_007187  
HGE017897 W01A044M09 pENTR-TOPO flj0034p21 AK001557 NM_007187  
HGE017903 W01A044M15 pENTR-TOPO flj0034p21 AK001557 NM_007187  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR046154 ARe15G10 pKA1U5 NM_007187.3  
GGGTCCCGGGGACTGAGTAAGGTGTCTGGATCGGAGGGAGGTTCGGGTGGGCATCGGGCG
HKR361608 RBd04A08 pGCAP10 NM_007187.3  
GCGCGGGGNCAGATCAAGGGGTACGGATCCCACGGATGTCCCGGTGGGNATGGGGCGGCT
HKR384156 RBd60G12 pGCAP10 NM_007187.3  
GAAGGTGTCTGGATCGGAGGGAGGTTCGGGTGGGCATCGGGCGGCTGGAAGAGCTCGACT
HKR474894 RBdS187D22 pGCAP10 NM_007187.3  
GGGGGACTGAGTAAGGTGTCTGGATCGGAGGGAGGTTCGGGTGGGCATCGGGCGGCTGGA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.09

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl