Prev. |  KEGG KO K16464 > 

RIKEN DNA Bank Human Resource - CEP250

Gene ID NCBI Gene 11190 |  KEGG hsa:11190
Gene Symbol CEP250
Protein Name centrosomal protein 250
Synonyms C-NAP1|CEP2|CNAP1
Ortholog resources KEGG ortholog (KEGG orthology K16464) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Individualy Deposited Resource

Catalog number Name of Resource Description
RDB04564 SEREX clone NGO-Br-69 (ID 1312, 1313) #1 SEREX clone NGO-Br-69 (ID 1312, 1313) #1

RDB_org_190226.csv


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY103309 IRAL058E13 pOTB7 BC071869 NM_007186 Partial/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR406198 RBdS015I06 pGCAP10 NM_007186.3  
GGGAGCAACTAGCCGGGCGTCTGCGGGAGCCGAGCGTGGTGAGGTTCACAGGTGGCTGTT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.20

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl