Prev. | 

RIKEN DNA Bank Human Resource - NISCH

Gene ID NCBI Gene 11188 |  KEGG hsa:11188
Gene Symbol NISCH
Protein Name nischarin
Synonyms I-1|IR1|IRAS|hIRAS
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY019106 IRAK047M18 pBluescriptR BC038102 NM_007184 Full/var
HGX039506 IRAK098M18 pCMV-SPORT6 BC054494 NM_007184 Full/var
HGX043034 IRAK107J18 pCMV-SPORT6 BC050552 NM_007184 Partial/var
HGX047874 IRAK119L10 pCMV-SPORT6 BC056900 NM_007184 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR432596 RBdS081I04 pGCAP10 NM_007184.3  
GGGAGACCCGAACNTGGCGACCGCGCGCACCTTCGGGCCCGAGCGGGAAGCCGAGCCGGC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl