Prev. | Human A to Z list > N > 

RIKEN DNA Bank Human Resource - NISCH

Gene ID (NCBI) 11188
Gene Symbol NISCH
Protein Name nischarin
Synonyms I-1|IR1|IRAS|hIRAS
Databases KEGG link 01 |  NCBI Gene link 01


Genome Network Project (GNP) Human Full-Length cDNA Clone link 01

Catalog number Clone name Vector(1) Sequence CDS status(3)
Submitted (DDBJ)(2) Refered (NCBI mRNA)
HGY019106 IRAK047M18 pBluescriptR BC038102 NM_007184 Full/var
HGX039506 IRAK098M18 pCMV-SPORT6 BC054494 NM_007184 Full/var
HGX043034 IRAK107J18 pCMV-SPORT6 BC050552 NM_007184 Partial/var
HGX047874 IRAK119L10 pCMV-SPORT6 BC056900 NM_007184 Full/var

(1) Extra 1,250 YEN (license fee) is required for Gateway® Expression Clone (pCMV SPORT6 and related vectors).
(2) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(3) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_160505.csv
GNP_full_IRAL_160505.csv


NRCD Human Full-Legth cDNA Clone link 01

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1)
5'-terminal sequence(2)
HKR432596 RBdS081I04 pGCAP10 NM_007184.3
GGGAGACCCGAACNTGGCGACCGCGCGCACCTTCGGGCCCGAGCGGGAAGCCGAGCCGGC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2016.08.03

Homo_sapiens_gene_info140110 - RDB_hum_GIxxxxxxxxx_html_160505.pl