Prev. |  KEGG KO K08144 > 

RIKEN DNA Bank Human Resource - SLC2A6

Gene ID NCBI Gene 11182 |  KEGG hsa:11182
Gene Symbol SLC2A6
Protein Name solute carrier family 2 member 6
Synonyms GLUT6|GLUT9|HSA011372
Ortholog resource in our bank

  SLC2A6

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX011211 IRAK028A11 pCMV-SPORT6 BC013740 NM_017585 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE084425 M01C011B01 pDONR221 FLJ03-C01 AK074927 ENST00000371902  
HGE084473 M01C011D01 pDONR221 FLJ03-C01 AK074927 ENST00000371902  
HGE084521 M01C011F01 pDONR221 FLJ03-C01 AK074927 ENST00000371902  
HGE084569 M01C011H01 pDONR221 FLJ03-C01 AK074927 ENST00000371902  
HGE084617 M01C011J01 pDONR221 FLJ03-C01 AK074927 ENST00000371902  
HGE084665 M01C011L01 pDONR221 FLJ03-C01 AK074927 ENST00000371902  
HGE084713 M01C011N01 pDONR221 FLJ03-C01 AK074927 ENST00000371902  
HGE084761 M01C011P01 pDONR221 FLJ03-C01 AK074927 ENST00000371902  
HGE084448 M01C011B24 pDONR221 FLJ03-D12 AK074927 ENST00000371902  
HGE084496 M01C011D24 pDONR221 FLJ03-D12 AK074927 ENST00000371902  
HGE084544 M01C011F24 pDONR221 FLJ03-D12 AK074927 ENST00000371902  
HGE084592 M01C011H24 pDONR221 FLJ03-D12 AK074927 ENST00000371902  
HGE084640 M01C011J24 pDONR221 FLJ03-D12 AK074927 ENST00000371902  
HGE084688 M01C011L24 pDONR221 FLJ03-D12 AK074927 ENST00000371902  
HGE084736 M01C011N24 pDONR221 FLJ03-D12 AK074927 ENST00000371902  
HGE084784 M01C011P24 pDONR221 FLJ03-D12 AK074927 ENST00000371902  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR205459 ARiS013K19 pGCAP10 NM_017585.3  
GCTCTCTGGGCCTCGGTTTCCACCCCGCGGGAGCGAGTACGACAGGGGCTGCGCGCATTG
HKR249132 ARiS122N20 pGCAP10 NM_017585.3  
CGGCCGGCCGATGGCTGCTGGCCCCGGGCGGCTGCTCCAGTCTGAGCGCCCTCCGCTCGC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.10

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl