Prev. | 

RIKEN DNA Bank Human Resource - PSIP1

Gene ID NCBI Gene 11168 |  KEGG hsa:11168
Gene Symbol PSIP1
Protein Name PC4 and SFRS1 interacting protein 1
Synonyms DFS70|LEDGF|PAIP|PSIP2|p52|p75
Links

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY042559 IRAK106G15 pBluescript BC044568 NM_033222 Partial/var
HGX056643 IRAK141K03 pCMV-SPORT6 BC064135 NM_021144 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR248830 ARiS122B06 pGCAP10 NM_021144.3  
AGCAGCGCANCTACGGCGGCGGCAGCGGCGGCNCGGTTGCGATTCCGAGCCGTTGAGACG
HKR330857 RBb27C09 pGCAP1 NM_021144.3  
GGGGCGCCGAGCGGGAGCCGCGCGGGTAGCAGCGCAGCATACNTGCGGCGGCAGCGGCGG
HKR430261 RBdS075K21 pGCAP10 NM_021144.3  
AGCAGCGCAGCTACGGCGGCGGCAGCGGCGGCGCGGTTGCGATTCCGAGCCGTTGAGACG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.20

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl