Prev. | 

RIKEN DNA Bank Human Resource - FSTL1

Gene ID NCBI Gene 11167 |  KEGG hsa:11167
Gene Symbol FSTL1
Protein Name follistatin like 1
Synonyms FRP|FSL1|MIR198|OCC-1|OCC1|tsc36
Links

  KEGG gene

  NCBI Gene


Individualy Deposited Resource

Catalog number Name of Resource Description
RDB03753 SEREX clone NGO-St-074 (ID 41, 543) #2 SEREX clone NGO-St-074 (ID 41, 543) #2
RDB04534 SEREX clone NGO-Co-6 (ID 2241) #1 SEREX clone NGO-Co-6 (ID 2241) #1

RDB_org_190226.csv


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY083131 IRAL007N19 pOTB7 BC000055 NM_007085
HGY095318 IRAL038E22 pDNR-LIB BC017413 NM_007085 Partial/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR044435 ARe11B11 pKA1U5 NM_007085.4  
GGCATTTCCCTCCGAAGGCTGGTCGAATCGTGCGGTAGCCTCCCACCTCCGCGTTACAGC
HKR050059 ARe25C11 pKA1U5 NM_007085.4  
GGCATTTCCTCCGAGGCTGGCGATCGGCGGAGCTCCCACCTCCGCTTACAGCTCGCTGCC
HKR054410 ARe36A10 pKA1U5 NM_007085.4  
GCTCCGAGGCTGGCGATCGGCGGAGCTCCCACCTCCGCTTACAGCTCGCATGCCGCCGTC
HKR059673 ARe49D01 pKA1U5 NM_007085.4  
GGCATTTCCTCCGAGGCTGGCGATCGGCGGAGCTCCCACCTCCGCTTACAGCTCGCTGCC
HKR064575 ARe61H07 pKA1U5 NM_007085.4  
GTCCGAGGCTGGCGATCGGCGGAGCTCCCACCCCCTTTTTACAGCATCGCTGCCGCCGAT
HKR073708 ARe84E12 pKA1U5 NM_007085.4  
ATCCTGCGAGGTCTTAAGGGGCGGCGAGGGGAGGTCGCATTTCCTCCGAGGCTGGCGATC
HKR081635 ARf04B11 pKA1U5 NM_007085.4  
GCTCCTCCGAGGCTGGCGATCGGCGGAGCTCCCACCTCCGCTTACAGCTCGCTGCCGCCG
HKR165280 ARi13D08 pGCAP10 NM_007085.4  
CGGCCGGCCGATGGCATTTCCTCCGAGGCTGGCGATCGGCGGAGCTCCCACCTCCGCTTA
HKR169683 ARi24D11 pGCAP10 NM_007085.4  
GTTTTTCCTCCGAGGCTGGCGATCGGCGGAGCTCCCACCTCCGCTTACAGCTCGCTGCCG
HKR184903 ARi62E07 pGCAP10 NM_007085.4  
CGGCCGGCCGATGTCCTCCGAGGCTGGCGATCGGCGGAGCTCCCACCTCCGCTTACAGCT
HKR219745 ARiS049G01 pGCAP10 NM_007085.4  
CGGCCGGCCGATGATTTCCTCCGAGGCTGGCGATCGGCGGAGCTCCCACCTCCGCTTA
HKR235095 ARiS087M07 pGCAP10 NM_007085.4  
GTCNNCCNNNGNTNNNNATCNNCNNANCTCCNACCNCCGCTTACAGCTCGCTGCCNCCNT
HKR235317 ARiS088E21 pGCAP10 NM_007085.4  
GACAGCTCGCTGCCGCCGTCCTGCCCCGCGCCCCCAGGAGACCTGGACCAGACCACGATG
HKR238642 ARiS096K02 pGCAP10 NM_007085.4  
GTCCTCCGAGGCTGGCGATCGGCGGAGCTCCCACCTCCGCTTACAGCTCGCTGCCGCCGT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.20

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl