Prev. |  KEGG KO K12625 > 

RIKEN DNA Bank Human Resource - LSM6

Gene ID NCBI Gene 11157 |  KEGG hsa:11157
Gene Symbol LSM6
Protein Name LSM6 homolog, U6 small nuclear RNA and mRNA degradation associated
Synonyms YDR378C
Ortholog resource in our bank

  LSM6

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX006187 IRAK015H19 pCMV-SPORT6 BC016026 NM_007080 Full
HGX016833 IRAK042B09 pCMV-SPORT6 BC019894 NM_007080 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE020823 W01A052A23 pENTR-TOPO IRAK015H19 BC016026 NM_007080  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR069774 ARe74H06 pKA1U5 NM_007080.2  
GGGTTTTGGCTGGGATCATCCGCGGCGGCCGGGCTCGTGGGGCGCCTGGAGTGAGGGTTC
HKR174145 ARi35G01 pGCAP10 NM_007080.2  
GGGTTTTGGCTGGGATCATCCGCGGCGGCCGGGCTCGTGGGGCGCCTGGAGTGAGGGTTC
HKR390524 RBd76F04 pGCAP10 NM_007080.2  
GATCCGCGGCGGCCGGGCTCGTGGGGCGCCTGGAGTGAGGGTTCTGGTTCCCGCCGGCGA
HKR442064 RBdS105C16 pGCAP10 NM_007080.2  
TGGCTTTCGGTTTTGGCTGGGATCATCCGCGGCGGCCGGGCTCGTGGGGCGCCTGGAGTG
HKR471074 RBdS177L10 pGCAP10 NM_007080.2  
GCCCCTGCCTCGGCGCTTTCGGTTTTGGCTGGGATCATCCGCGGCGGCCGGGCTCGTGGG
HKR475006 RBdS187I14 pGCAP10 NM_007080.2  
GATCCGCGGCGGCCGGGCTCGTGGGGCGCCTGGAGTGAGGGTTCTGGTTCCCGCCGGCGA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl